Сообщение о х колумбе: Христофор Колумб биография кратко – главные открытия по географии и интересные факты для детей (5 класс)

Содержание

Доклад про Колумба

Христофор Колумб — знаменитый испанский мореплаватель пятнадцатого века. Родился он в 1451 году в Италии в бедной семье. Однако, благодаря своему живому уму, получил хорошее образование — окончил Павийский университет, а затем женился на дочери одного из мореплавателей того времени, что могло оказать свою роль при дальнейшем выборе профессии.

Колумб занимался тем, что пытался найти кратчайший морской путь из Европы в Индию. Всего он совершил 4 таких плавания, а во время первого из них открыл Америку, но при совей жизни так и не узнал об этом.

Первый морской поход

В те времена считалось, что если переплыть Атлантический океан, то можно сразу оказаться в Азии, на побережье Китая. Географ Паоло Тосканелли подсчитал, что для того, чтобы добраться до азиатского побережья через Атлантику, надо проплыть 5600 км, Колумб произвёл все необходимые расчёты и вышло так, что именно на таком расстоянии он и обнаружил сушу.

Он был уверен, что открыл путь к Индии, поэтому местных жителей назвал индейцами.

Готовился к первому походу он очень долго — более десяти лет. Ходил на разных судах, побывал во многих местах. Всё это время занимался самообразованием, вёл переписку со многими учёными того времени. Основной проблемой было то, что он долго не мог найти спонсора данной экспедиции и постоянно получал отказ. В итоге в свой первый поход он отправился лишь в 1492 году, получив покровительство испанской королевы Изабеллы.

Последующие морские походы

После возвращения из первого похода, Колумб хвастался теми золотыми украшениями, которые получил у местных жителей. Король и Королева Испании быстро организовали ещё одну экспедицию, во время которой Колумбу удалось лучше исследовать новые земли.

Но на его беду, в 1498 году португалец Васко да Гама открыл путь в Индию через Африку и начал вести торговлю. На фоне этого достижения, все открытия Колумба были забыты, ведь ему так и не удалось начать торговать с новыми землями, и открытые территории на то время не приносили никакой практической выгоды.

Умер Колумб в 1506 году в нищете. Из своего последнего похода он вернулся тяжело больным и не смог противостоять кредиторам, которые забрали всё его имущество.


Если это сообщение тебе пригодилось, буда рада видеть тебя в группе ВКонтакте. А ещё — спасибо, если ты нажмёшь на одну из кнопочек «лайков»:

Вы можете оставить комментарий к докладу.

Колумб Христофор


XPOHOC
ВВЕДЕНИЕ В ПРОЕКТ
ФОРУМ ХРОНОСА
НОВОСТИ ХРОНОСА
БИБЛИОТЕКА ХРОНОСА
ИСТОРИЧЕСКИЕ ИСТОЧНИКИ
БИОГРАФИЧЕСКИЙ УКАЗАТЕЛЬ
ПРЕДМЕТНЫЙ УКАЗАТЕЛЬ
ГЕНЕАЛОГИЧЕСКИЕ ТАБЛИЦЫ
СТРАНЫ И ГОСУДАРСТВА
ЭТНОНИМЫ
РЕЛИГИИ МИРА
СТАТЬИ НА ИСТОРИЧЕСКИЕ ТЕМЫ
МЕТОДИКА ПРЕПОДАВАНИЯ
КАРТА САЙТА
АВТОРЫ ХРОНОСА

Родственные проекты:
РУМЯНЦЕВСКИЙ МУЗЕЙ
ДОКУМЕНТЫ XX ВЕКА
ИСТОРИЧЕСКАЯ ГЕОГРАФИЯ
ПРАВИТЕЛИ МИРА
ВОЙНА 1812 ГОДА
ПЕРВАЯ МИРОВАЯ
СЛАВЯНСТВО
ЭТНОЦИКЛОПЕДИЯ
АПСУАРА
РУССКОЕ ПОЛЕ

Христофор Колумб

Открытия Колумба имели всемирно-исторические значение

Колумб (лат.

Columbus; итал. Colombo, исп. Colón), Христофор (29.X.1451 — 20.V.1506) — мореплаватель. По происхождению генуэзец, родился в семье ткача. Около 1472 года стал моряком, в 1476 году прибыл в Португалию, участвовал в португальских плаваниях в Северной Атлантике, жил несколько лет на Мадейре, возможно, около 1482 года посетил Гвинею. Проект плавания к восточным берегам Азии западным путем Колумб разработал на основании учения о шарообразности Земли и расчетов космографов 15 века, значительно преуменьшавших протяженность океанического пространства к Западу от Европы. В 1485 году проект Колумба был отвергнут португальским королем, и Колумб переселился в Кастилию, где после 7 лет борьбы за принятие этого проекта при поддержке андалусских и арагонских купцов и банкиров добился успеха. 17 апреля 1492 года Изабелла и Фердинанд заключили с Колумбом договор (капитуляцию) и обещали ему в случае удачи титул адмирала и вице-короля всех земель, которые будут им открыты при плавании на Запад.
3 августа 1492 года 3 каравеллы («Санта-Мария», «Нинья» и «Пинта») с экипажем в 90 человек вышли из Палоса. Миновав Канарские острова, Колумб взял курс на Запад и в ночь с 11 на 12 октября 1492 года открыл один из Багамских островов, названный им Сан-Сальвадор (Гуанахани). 27 октября Колумб открыл северо-восточный берег Кубы, 6 декабря — остров Эспаньолу (Гаити). Потеряв у берегов Эспаньолы флагманский корабль «Санта-Марию», Колумб на «Нинье» в марте 1493 года вернулся в Кастилию.

Сообщение об открытии богатых земель, которые Колумб счел частью Восточной Азии, побудили кастильские власти организовать 2-ю экспедицию. 25 сентября 1493 года Колумб покинул Кадис. Открыв ряд Малых Антильских островов и Пуэрто-Рико, прибыл на Эспаньолу, где испанцы основали несколько поселений. В апреле — сентябре 1494 года Колумб открыл южный берег Кубы и остров Ямайку, после чего возвратился на Эспаньолу. В 1495 году и в начале 1496 года организовал на Эспаньоле ряд походов против индейцев, восставших против испанских колонизаторов, затем вернулся в Испанию.

В конце июля — августе 1498 года во главе 3-й экспедиции Колумб открыл остров Тринидад и дельту реки Ориноко и участок северного побережья Южной Америки. В 1500 году Изабелла и Фердинанд в связи с мятежами испанских колонистов против Колумба сместили его и совершенно отстранили от управления новооткрытыми землями.

В июле 1502 — мае 1503 года Колумб в ходе 4-й экспедиции открыл Карибский берег Центральной Америки (от мыса Гондурас до Дарьенского залива). В ноябре 1504 года Колумб вернулся в Испанию. Умер в Вальядолиде.

О целях 1-й экспедиции Колумба и его приоритете в открытии Антильских островов, Южной и Центральной Америки в литературе идет долгая дискуссия. Но ни один из «антиколумбианцев» не мог привести сколько-нибудь убедительных доказательств против приоритета Колумба. Бесспорно, Северо-Восточная Америка открыта была норманнами приблизительно за 500 лет до Колумба. Возможно, что до Колумба европейские или африканские суда случайно пересекали Атлантический океан.

Однако только открытия Колумба имели всемирно-исторические значение, поскольку лишь после его первого плавания американские земли вошли в сферу географических представлений. Открытия Колумба способствовали ломке средневекового мировоззрения и были тесно связаны с общим ходом развития капиталистического способа производства и колониальной экспансией.

Я. М. Свет. Москва.

Советская историческая энциклопедия. В 16 томах. — М.: Советская энциклопедия. 1973—1982. Том 7. КАРАКЕЕВ — КОШАКЕР. 1965.

Источники: Путешествия Христофора Колумба. Дневники, письма, документы, пер. с исп., 4 изд., М., 1961.

Литература: Морисон С. Э., Христофор Колумб, мореплаватель, пер. с англ., М., 1958.


Вернуться на главную страницу Колумба

 

 

Христофор Колумб (1451–1506 гг.) | География 6 класс

Знаменитый мореплаватель, открывший для европейцев Америку.

Колумб – итальянец по происхождению, родился в г. Генуя (Северная Италия) в семье ткача. Генуя – портовый город, и Колумб с детства обучался морскому делу. Много лет спустя он напишет в своем дневнике: «В раннем детстве вступил я в море и продолжаю плавать в нем и поныне, и таково призвание всякого, кто упорно желает познать тайны мира сего». Море научило его многому: не бояться опасностей, переносить тяготы и лишения, преодолевать трудности, добиваться намеченной цели.

Движимый страстью «познать тайны мира», Колумб в 1484 г. предложил королю Португалии Хуану II проект плавания к восточным берегам западным путем, через Атлантику. За будущие открытия во славу португальской короны Колумб хотел получить дворянское звание, титул Главного адмирала, должность вице-короля неизведанных земель, десятую долю дохода с этих территорий, восьмую долю от торговли с ними и… золотые шпоры. Король счел претензии генуэзца чрезмерными и проект отклонил.

Однако Колумб не сдавался. Он предложил свой проект королеве Испании Кастилии Изабелле и ее супругу королю Арагону Фердинанду. Поначалу и они отказались от проекта, однако в 1492 г. приняли его и подписали с Колумбом договор на его условиях. В августе мореплаватель Христофор Колумб, исходя из представления о шарообразности Земли, предпринял попытку достичь Индии, двигаясь на запад по Атлантическому океану. Испанское правительство выделило ему три каравеллы, и в 1492 г. (считается годом открытия Америки) экспедиция под руководством Колумба достигла одного из Багамских островов.

Затем он совершил еще три плавания, открыл острова Пуэрто-Рико, Ямайку и несколько небольших островов из группы Малых Антильских, побережье Южной и Центральной Америки. Из четвертого плавания Колумб возвратился в 1504 г. В 1506 г. Колумб умер в одном из маленьких монастырей, так и не поняв, что им открыт неизвестный европейцам материк, будучи в полной уверенности, что открыл новый путь в Индию.

Что открыл Христофор Колумб? Открытия Христофора Колумба.

Христофор Колумб — биография, путешествия, открытия

Содержание статьи

КОЛУМБ, ХРИСТОФОР (Cristoforo Colombo, Cristobal Colon) (1451–1506), испанский мореплаватель, открывший Америку. Итальянец по происхождению. Родился в Генуе между 25 августа и 31 октября 1451 в семье ткача-шерстянщика Доменико Коломбо. В 1470 начал активно участвовать в коммерческих операциях (до 1473 под руководством своего отца). В 1474–1479 совершил несколько плаваний в составе торговых экспедиций генуэзской компании Чентурионе-Негро: посетил о.Хиос, Англию, Ирландию, о-ва Порто-Санто и Мадейра. В 1476 обосновался в Португалии . В 1482–1484 побывал на Азорских о-вах и на гвинейском побережье (форт Сан-Жоржи-да-Мина).

В начале 1480-х приступил к разработке проекта плавания к берегам Восточной Азии западным путем через Атлантический океан ; на эту мысль его натолкнули труды Аристотеля , Сенеки , Плиния Старшего , Страбона , Плутарха , Альберта Великого и Роджера Бэкона , главным же вдохновителем его был флорентийский картограф Паоло Тосканелли (1397–1482). В 1484 представил свой проект португальскому королю Жуану II (1481–1495) . Однако весной 1485 Математическая Хунта (Лиссабонская академия астрономии и математики) признала расчеты Колумба «фантастическими». Летом 1485 уехал в Испанию (Кастилию) и в январе 1486 предложил свой проект испанской королевской чете – Фердинанду II Арагонскому (1479–1516) и Изабелле I Кастильской (1474–1504) , которые создали для его рассмотрения специальную комиссию во главе с Э. де Талаверой. Летом 1487 комиссия вынесла неблагоприятное заключение, тем не менее Фердинанд и Изабелла отложили решение до окончания войны с Гранадским эмиратом.

Осенью 1488 Колумб посетил Португалию, чтобы повторно предложить свой проект Жуану II, но вновь получил отказ и вернулся в Испанию. В 1489 безуспешно пытался заинтересовать идеей плавания на запад регентшу Франции Анну де Боже и двух испанских грандов – герцогов Энрике Мединасидония и Луиса Мединасели. Но после падения Гранады при поддержке влиятельных покровителей при испанском дворе он смог добиться согласия Фердинанда и Изабеллы: 17 апреля 1492 королевская чета заключила с Колумбом договор («капитуляция») в Санта-Фе, пожаловав ему дворянское звание, титулы Адмирала Моря-Океана, вице-короля и генерал-губернатора всех островов и материков, которые он откроет. Должность адмирала давала Колумбу право выносить решение в спорах, возникающих по делам торговли, должность вице-короля делала его личным представителем монарха, а должность генерал-губернатора обеспечивала высшую гражданскую и военную власть. Колумбу предоставлялось право на получение десятой доли всего найденного в новых землях и восьмой доли прибылей от торговых операций с заморскими товарами. Испанская корона обязалась финансировать большую часть расходов экспедиции.

Иван Кривушин

3 августа 1492 года началась первая экспедиция мореплавателя Христофора Колумба, открывшего для европейцев новые земли.

Родившийся в Генуе, Колумб стал моряком в раннем возрасте, плавал по Средиземному морю на торговых судах. Затем обосновался в Португалии. Под португальским флагом плавал на север в Англию и Ирландию, ходил вдоль западного побережья Африки до португальского торгового пункта Сан-Жоржи-да-Мина (современная Гана). Он занимался торговлей, составлением карт и самообразованием. В этот период у Колумба возникла идея добраться до Индии западным путем через Атлантический океан .

В то время многие западноевропейские страны искали морские пути в страны Южной и Восточной Азии, которые тогда объединялись общим названием «Индия». Из этих стран в Европу поступали перец, мускатный орех, гвоздика, корица, дорогие шелковые ткани. Торговцы из Европы не могли проникнуть в страны Азии наземным путем, так как турецкие завоевания перекрыли традиционные купеческие связи с Востоком через Средиземное море. Они были вынуждены приобретать азиатские товары у арабских купцов. Поэтому европейцы были заинтересованы в поиске морского пути в Азию, что позволило бы им приобретать азиатские товары, минуя посредников. В 1480-х годах португальцы пытались обогнуть Африку, чтобы проникнуть через Индийский океан в Индию.

Колумб же выдвинул предположение, что в Азию можно попасть, двигаясь на запад через Атлантический океан. Его теория была основана на античном учении о шарообразности Земли и неверных расчетах ученых XV века , которые считали земной шар значительно меньшим по размеру, а также занижали реальную протяженность Атлантического океана с запада на восток.

Между 1483 и 1484 годами Колумб попытался заинтересовать португальского короля Жуана II своим планом экспедиции в Азию западным путем. Монарх передал его проект на экспертизу ученым «Математической Хунты» (Лиссабонская академия астрономии и математики). Эксперты признали расчеты Колумба «фантастическими», и король отказал Колумбу .

Не получив поддержки, в 1485 году Колумб отправился в Испанию. Там в начале 1486 года он был представлен королевскому двору и получил аудиенцию у короля и королевы Испании — Фердинанда II Арагонского и Изабеллы Кастильской. Королевская чета заинтересовалась проектом западного пути в Азию. Для его рассмотрения была создана специальная комиссия, которая летом 1487 года вынесла неблагоприятное заключение, но испанские монархи отложили решение об организации экспедиции до окончания войны, которую они вели с Гранадским эмиратом (последнее мусульманское государство на Пиренейском полуострове).

Осенью 1488 года Колумб посетил Португалию, где повторно предложил свой проект Жуану II, но вновь получил отказ и вернулся в Испанию.

В 1489 году он безуспешно пытался заинтересовать идеей плавания на запад регента Франции Анну де Боже и двух испанских герцогов.

В январе 1492 года, не выдержав длительной осады испанскими войсками, Гранада пала . После долгих переговоров испанские монархи, отвергнув возражения своих советников, согласились субсидировать экспедицию Колумба.

17 апреля 1492 года королевская чета заключила с ним договор («капитуляция») в Санта-Фе, пожаловав ему дворянское звание, титулы адмирала Моря-Океана, вице-короля и генерал-губернатора всех островов и материков, которые он откроет. Звание адмирала давало Колумбу право выносить решение в спорах, возникающих по делам торговли, должность вице-короля делала его личным представителем монарха, а должность генерал-губернатора обеспечивала высшую гражданскую и военную власть. Колумбу предоставлялось право на получение десятой доли всего найденного в новых землях и восьмой доли прибылей от торговых операций с иностранными товарами.

Испанская корона обязалась финансировать большую часть расходов экспедиции. Часть средств на нее мореплавателю дали итальянские купцы и финансисты.

Остров он назвал Сан-Сальвадор (Св. Спасителя), а его жителей — индейцами, полагая, что оказался у берегов Индии.

Однако до сих пор продолжается дискуссия по поводу первого места высадки Колумба. Долгое время (1940-1982) Сан-Сальвадором считался остров Уотлинг. В 1986 году американский географ Джордж Джадж обработал на компьютере все собранные материалы и пришел к выводу: первой увиденной Колумбом американской землей был остров Самана (120 км юго-восточнее Уотлинга).

14-24 октября Колумб подходил еще к нескольким Багамским островам. Узнав от аборигенов о существовании на юге богатого острова, корабли 24 октября покинули Багамский архипелаг и поплыли дальше на юго-запад. 28 октября Колумб высадился на северо-восточном побережье Кубы, названной им «Хуаной». После этого испанцы, воодушевленные рассказами туземцев, потратили месяц на поиски золотого острова Банеке (современный Большой Инагуа).

21 ноября капитан «Пинты» Мартин Пинсон увел свой корабль, решив самостоятельно искать этот остров. Потеряв надежду найти Банеке, Колумб с двумя оставшимися судами повернул на восток и 5 декабря достиг северо-западной оконечности острова Бохио (современный Гаити), которому дал имя Эспаньола («Испанский»). Двигаясь вдоль северного побережья Эспаньолы, экспедиция 25 декабря подошла к Святому мысу (современный Кап-Аитьен), где «Санта-Мария» села на мель и затонула, но экипаж спасся. С помощью местных жителей с корабля удалось снять пушки, припасы и ценный груз. Из обломков судна построили форт — первое европейское поселение в Америке, нареченное по случаю праздника Рождества «Навидад» («рождественский город»).

Потеря корабля заставила Колумба оставить в основанном поселении часть команды (39 человек) и отправиться на «Нинье» в обратный путь. Впервые в истории мореходства по его приказу под матросские койки были приспособлены индейские гамаки. Для доказательства того, что достиг части света, ранее не известной европейцам, Колумб взял с собой семь плененных жителей островов, диковинные перья птиц и плоды невиданных в Европе растений. Побывав на открытых островах, испанцы впервые увидели кукурузу, табак, картофель.

4 января 1493 года Колумб на «Нинье» вышел в море и поплыл на восток вдоль северного побережья Эспаньолы. Через два дня он встретил «Пинту». 16 января оба корабля взяли курс на северо-восток, пользуясь попутным течением — Гольфстримом. 12 февраля поднялась буря, и в ночь на 14 февраля корабли потеряли друг друга из виду. На рассвете 15 февраля моряки увидели землю, и Колумб определил, что находится у Азорских островов. 18 февраля «Нинье» удалось пристать к берегу одного из островов — Санта-Марии.

24 февраля «Нинья» покинула Азорские острова. Через два дня она вновь попала в бурю, которая 4 марта прибила ее к берегу Португалии. 9 марта «Нинья» бросила якорь в порту Лиссабона. Команде была нужна передышка, а судно требовало починки. Король Жуан II дал Колумбу аудиенцию, на которой мореплаватель известил его об открытии им западного пути в Индию. 13 марта «Нинья» смогла отплыть в Испанию. 15 марта 1493 года, на 225-й день плавания, корабль вернулся в испанский порт Палос. В тот же день туда пришла и «Пинта».

Король Фердинанд II Арагонский и королева Изабелла Кастильская оказали Колумбу торжественный прием и в дополнении к ранее обещанным привилегиям дали ему разрешение на новую экспедицию.

В ходе первого путешествия Колумбом была открыта Америка, принятая им за Восточную Азию и названная Вест-Индией. Европейцы впервые ступили на острова Карибского моря — Хуану (Кубу) и Эспаньолу (Гаити). В результате экспедиции стала достоверно известна ширина Атлантического океана, обнаружено Саргассово море, установлено течение воды океана с запада на восток, впервые было отмечено непонятное поведение магнитной стрелки компаса. Политическим резонансом плавания Колумба явился «папский меридиан»: глава католической церкви установил в Атлантике демаркационную линию, указавшую соперничавшим Испании и Португалии различные направления для открытий новых земель.

В 1493-1504 годах Колумб совершил еще три плавания через Атлантический океан, в результате которых открыл часть Малых Антильских островов, побережье Южной и Центральной Америки. Мореплаватель умер в 1506 году, будучи в полной уверенности, что открытые им земли являлись частью Азиатского материка, а не новым континентом.

Материал подготовлен на основе информации РИА Новости и открытых источников

Имя: Христофо́р Колу́мб

Дата рождения: 26-08-1451

Место рождения: Генуя, Италия

Дата смерти: 20-11-1506

Деятельность: испанский мореплаватель, в 1492 году открывший для европейцев Америку

Трудно сказать, какая жажда влечет людей в дальние страны. Любопытство и нажива растут из одного корня. В его время о неведомых землях рассказывали чудеса. Несметные сокровища и причудливые существа будоражили воображение. Христофор Колумб отправляется в неизвестность, потому что любопытство сильнее страха. Едва он понял, что туземцы не представляют угрозы, он провозглашает открытую им «терру» владением испанской короны. До конца своих дней он считал, что приплыл в Индию, и с его легкой руки аборигенов Америки стали называть индейцами.

Генуэзское детство

Христофор Колумб происходил из скромной генуэзской фамилии и родился в1451 году. Точная дата, как и место его рождения неизвестны, что дает пищу для полемики шести городам Испании и Италии. Он получил образование в Павийском университете, женился и продолжил дело отца, став мореходом. Участие в торговых экспедициях приносит ему какой-то заработок, но не удовлетворение. Молодой человек грезит о неведомых странах и опасных путешествиях.

Говорят, муза странствий начинает манить от внутренней неудовлетворенности и душевного разлада. Таким людям скучно или тесно жить среди своих соплеменников. Эти мечтатели хотят отыскать рай на земле, где текут молочные реки и лоснятся кисельные берега. Просвещенные умы уже догадываются, что Земля круглая, но это еще предстоит доказать географическими открытиями. Об Индии знают лишь понаслышке, но за ее несметные богатства готовы бороться просвещенные монархи.

Безумная мечта

Мы не знаем, что послужило поводом, но 1474 году Колумб переезжает в Португалию, где живет 9 лет. Свое «великое бегство» за океан он готовит основательно. Его вдохновителем был астроном и географ Паоло Тосканелли, предположивший, что в сказочную Индию можно добраться, плывя на запад. Колумб посещает Англию, Ирландию и Исландию, где собирает сведения о путешествиях викингов, участвует в экспедиции на Гвинею. Его план обогнуть Землю и добраться до благословенной Индии с другой стороны был насколько смелым, что казался нелепостью. Мудрые правители Генуи, Англии и Португалии не решились дать ему денег, людей и корабли. И только католические величества Испании, страны, которая еще воевала с маврами на южной своей окраине, готовы обсуждать предложение безумца из Генуи. В 1482 году, после освобождения Гранады, королева Изабелла соглашается финансировать заокеанский проект Колумба. Он назначается вице-королем неоткрытых еще земель и адмиралом бескрайних морских пустынь.

К сожалению, кроме громкого титула и спонсорских обещаний, он не получает от Изабеллы почти ничего. Частные лица Мартин Алонсо Пинсон, Хуан де ла Коса и Хуан Ниньо снабжают его деньгами и кораблями. Три судна: «Санта-Мария», «Пинта» и «Нинья» отправляются в неизвестность 3 августа 1492 года.

Первая экспедиция Христофора Колумба

За три месяца экспедиция без приключений пересекла Атлантический океан, попутно открыв Саргассово море, наполненное водорослями. 12 октября 1482 года матросом Родриго де Триана был обнаружен «авангард» нового континента. Остров, на который ступила нога первых европейцев, теперь называется Гуанахани и входит в состав Багамских островов. Местные жители не знали стыда наготы, железа и страха перед пришельцами. Они не были ни японцами, которых рассчитывал обнаружить Колумб, ни неграми, ни индусами. Ритуальные узоры на теле, кусочки золота и листья табака стали первыми открытиями испанцев.

Колумб постепенно продвигается вдоль Багамских островов на юг, обнаруживая более развитые племена. Жители этих земель пользуются гамаком, выращивают картофель, маис, табак и хлопчатник. Все еще полагая, что он приплыл в Юго-Восточную Азию, Колумб открывает Кубу. Туземцы живут в тростниковых хижинах и говорят, что золото есть на большой земле. 6 декабря 1482 года Колумб открывает Гаити и называет этот остров Эспаньолой.

Капитан и владелец «Пинты» уводит свой корабль в самостоятельные поиски, а «Санта-Мария» разбивается о рифы. Наскоро соорудив крепость на Гаити из обломков судна, Колумб оставляет в ней гарнизон из матросов, а сам на «Нинье» пускается в обратное плаванье, прихватив с собой нескольких туземцев. «Пинта» поджидает их у северного берега Гаити. 9 марта 1493 года корабли заходят в гавань Лиссабона, где их с почестями встречает португальский король.

Золотая лихорадка

Открытие Колумбом новых земель произвело переполох среди морских держав. Португалия чувствовала себя обманутой, ведь именно ей предоставили римские папы право владеть землями на западе. Новые приобретения Кастилии, как тогда называли Испанию, нарушали статус-кво. Папа Александр Борджиа примирил оба государства, указав меридиан, разделяющий будущие владения Испании и Португалии.

Ничто так не воодушевляет людей, как золото и новизна. Вторая экспедиция Колумба состоялась через полгода после первой. Около двух тысяч воинов, патеров, чиновников и дворян на семнадцати кораблях отправились осваивать новые земли и истреблять местных жителей. На Гаити закладывается город и порт Сан-Доминго. Открываются Малые Антильские и Виргинские острова, острова Пуэрто-Рико, Ямайка. На месте основанной в первое плавание крепости обнаружили следы пожарища и трупы. Болезни, пороки и месть туземцев истребили оставленных здесь моряков.

Бортовой журнал подробно рассказывает о желтой лихорадке, столкновениях с карибами и глухом недовольстве команды. Удушающая жара препятствует освоению новых земель и портит запасы продовольствия. Оставаясь на Гаити, Колумб пытается наладить добычу золота. Часть испанцев захватывает вновь прибывшие корабли с продовольствием и бежит. Другие разбредаются по острову, грабя и насилуя местных жителей. Туземцы умирают от неведомых болезней и бегут в горы.

Тем временем королевская чета недовольна Колумбом. Россыпей сокровищ не обнаружено, и в новые владения решено отправлять избыток пассионариев, которые не нашли себя в мирной жизни после окончания Реконкисты. Снабжение Индии и новых экспедиций поручено предприимчивому купцу Америго Веспуччи.

Третья экспедиция Христофора Колумба

Теперь ему приходится догонять ушлых предпринимателей, плывущих грабить ничейные земли. Третья экспедиция Колумба состоит из 6 небольших кораблей и трехсот человек команды, многие из которых навербованы из испанских тюрем. Прибыв на Эспаньолу (Гаити), которая была оставлена на попечение его брата Бартоломео, Колумб наблюдает полное одичание своих сородичей, которые требуют земельных наделов и невольников. Тяжело больной вице-король вынужден разрешить рабство и плантации.

В 1498 году португалец Васко де Гама проложил путь к истинной Индии, возвратившись с грузом пряностей. Королевская чета считает, что Колумб обманул их. Новому губернатору Эспаньолы Франсиско де Бобадилью дают неограниченные полномочия и приказ арестовать несчастного первооткрывателя Америки. Закованный в кандалы, он прибывает в Испанию.

Последнее плавание Христофора Колумба

Испанским финансистам удалось убедить короля в невиновности Христофора Колумба. Он отправляется в свою четвертую экспедицию, куда он берет брата Бартоломео и сына Эрнандо. В этом плавании он открывает остров Мартиника, достигает Центральной Америки и описывает нравы индейцев, чьи потомки живут на территориях современных государств Гондурас, Никарагуа, Коста-Рика и Панама. От жителей страны Верагуа он узнает, что Атлантический океан отделен от Южного моря (как называли Тихий океан) непреодолимым барьером.

Удача покинула великого мореплавателя. Губернатор Эспаньолы не разрешает Колумбу укрыться от шторма в бухте Сан-Доминго, городе, который он основал. Он так и не достигнет тихоокеанского побережья, которое бы увенчало его новой славой. Попытка основать новую колонию на континенте не удается из-за воинственности местного населения. От индейцев, живущих вдоль Дарьенского залива, он узнает, что белые люди уже здесь побывали. Он плывет к Ямайке и попадает на мель. Новый начальник Эспаньолы не торопится прийти на помощь соотечественнику. Колумбу удается напугать туземных царьков, предсказав лунное затмение. Аборигены снабжают моряков провизией.

Только через год удается спасти застрявших близ Ямайки испанцев. В сентябре 1504 года, преодолев неспокойный океан, братья Христофор и Бартоломео Колумбы возвращаются в Испанию. Нищий и больной, адмирал бескрайних морей умирает в Севилье 20 мая 1506 года. Известны его последние слова: «В твои руки, Господь, я предаю мой дух».

Посмертная слава

Думал ли он о том, что открытые им народы и земли обречены на истребление? Толпы алчных завоевателей устремились по проторенному им маршруту, чтобы крестить и грабить, убивать и насиловать. К чести испанцев, они не были расистами, как англичане. В бывших испанских колониях живут потомки прежних туземцев, воспринявшие культуру католической Европы. В Соединенных Штатах Америки, бывшей колонии Англии, индейцы почти полностью истреблены.

Страна, которой он подарил могущество и славу, лишила его привилегий при жизни и оставила умирать в нищете и безвестности. О нем вспомнили только в середине 16 века, когда золото и серебро Латинской Америки рекой потекло в Испанию.

Символична судьба его останков. Беспокойный дух адмирала словно влечет бездыханные кости по маршрутам, некогда им пройденным. Император Карл V Габсбург, исполняя последнюю волю мореплавателя, 2 1540 году перевозит его прах из Севильи в Сан-Доминго (Гаити). Когда на рубеже 18 и 19 веков французы отбирают часть Эспаньолы, испанцы перевозят мощи Колумба в Гавану (Куба). Наконец, в 1898 году после изгнания испанцев из Кубы, его останки вновь перевозятся в Сан-Доминго, а затем в Севилью. Вице-король Испании вновь напомнил о себе в конце 19 века, когда в главном соборе Сан-Доминго была обнаружена шкатулка с костями, на которой было начертано, что они принадлежат Христофору Колумбу. Севилья и Сан-Доминго начали долгий спор о том, где же на самом деле покоится великая реликвия.

Христофор Колумб (осень 1451 года, Генуэзская республика — 20 мая 1506, Вальядолид, Испания) — испанский мореплаватель итальянского происхождения, в 1492 году открывший для европейцев Америку.
Колумб первым из достоверно известных путешественников пересёк Атлантический океан в субтропической и тропической полосе северного полушария и первым из европейцев ходил в Карибском море. Он положил начало исследованию Южной и Центральной Америки. Он открыл все Большие Антильские острова — центральную часть Багамского архипелага, Малые Антильские острова, а также ряд мелких островов в Карибском море и остров Тринидад у берегов Южной Америки. Первооткрывателем Америки Колумба можно назвать с оговорками, ведь еще в Средние века на территории Северной Америки бывали европейцы в лице исландских викингов. Поскольку за пределами Скандинавии сведений об этих походах не было, именно экспедиции Колумба впервые сделали сведения о землях на западе всеобщим достоянием и положили начало колонизации Америки европейцами.
Колумб совершил 4 плавания к Америке:
Первое плавание (2 августа 1492 — 15 марта 1493).
Второе плавание (25 сентября 1493 — 11 июня 1496).
Третье плавание (30 мая 1498 — 25 ноября 1500).
Четвертое плавание (9 мая 1502 — ноябрь 1504).
Биография
Христофор Колумб — мореплаватель, вице-король «Индий» (1492), первооткрыватель Саргассова моря и Карибского моря, Багамских островов и Антильских островов, части северного побережья Южной Америки и карибской береговой черты Центральной Америки.
В 1492-1493 году Колумб руководил испанской экспедицией для поиска кратчайшего морского пути в Индию; на 3 каравеллах («Санта-Мария», «Пинта» и «Нинья») пересек Атлантический океан, открыл Саргассово море и достиг 12 октября 1492 острова Самана, позже — древних Багамских о-вов, Кубы, Гаити. В последующих экспедициях (1493-1496, 1498-1500, 1502-1504) открыл Большие Антильские, часть Малых Антильских островов и побережья Южной и Центральной Америки и Карибское море.
Христофор Колумб родился осенью 1451 года в Генуе, по происхождению генуэзец. Он был выше среднего роста, крепкого и ладного телосложения. Рыжеватые в юности волосы рано поседели, отчего он выглядел старше своих лет. На продолговатом морщинистом и обветренном лице с бородкой выделялись живые голубые глаза и орлиный нос. Его отличали вера в божественное провидение и предзнаменования, и в то же время редкостная практичность, болезненное самолюбие и подозрительность, страсть к золоту. Он обладал острым умом, даром убеждения и разносторонними познаниями. Христофор Колумб был дважды женат и имел от этих браков двоих сыновей.

Три четверти жизни Христофор Колумб провел в плавании.
Среди великих деятелей мировой цивилизации мало кто может сравниться с Колумбом по числу публикаций, посвященных его жизни, и одновременно по обилию «белых пятен» в биографии. Более или менее уверенно можно утверждать, что по происхождению он генуэзец и около 1465 года поступил на генуэзский флот, через некоторое время получил тяжелое ранение. До 1485 года Христофор плавал на португальских судах, жил в Лиссабоне и на островах Мадейра и Порту-Санту, занимаясь торговлей, составлением карт и самообразованием. Не выяснено, когда и где он составил проект западного, по его мнению, кратчайшего морского пути из Европы в Индию; проект был основан на античном учении о шарообразности Земли и на неверных расчетах ученых 15 века. В 1485 году после отказа португальского короля поддержать этот проект Колумб перебрался в Кастилию, где с помощью андалусских купцов и банкиров добился организации под своей командой правительственной морской экспедиции.
Первая экспедиция Христофора Колумба 1492-1493 годов в составе 90 человек на трех судах — «Санта-Мария», «Пинта» и «Нинья» — вышла из Палоса 3 августа 1492 года, от Канарских островов повернула на запад, пересекла Атлантический океан, открыв Саргассово море, и достигла острова в Багамском архипелаге, названного путешественником Сан-Сальвадор, где Колумб высадился 12 октября 1492 года. Долгое время Сан-Сальвадором считался остров Уотлинг. Однако, наш современник американский географ Дж. Джадж в 1986 году обработал на компьютере все собранные материалы и пришел к выводу: первой увиденной Колумбом американской землей был остров Самана. 14-24 октября Колумб подходил еще к нескольким Багамским островам, а 28 октября — 5 декабря открыл часть северо-восточного побережья Кубы. 6 декабря достиг острова Гаити и двинулся вдоль северного берега. В ночь на 25 декабря флагман «Санта-Мария» сел на риф, но экипаж спасся. Впервые в истории мореходства по приказу Колумба под матросские койки были приспособлены индейские гамаки. Колумб на «Нинье» 15 марта 1499 года вернулся в Кастилию. Политическим резонансом плавания Х. Колумба явился «папский меридиан»: глава католической церкви установил в Атлантике демаркационную линию, указавшую соперничавшим Испании и Португалии различные направления для открытий новых земель.
Вторая экспедиция (1493-96) , которую возглавил адмирал Колумб, в должности вице-короля вновь открытых земель, состояла из 17 судов с экипажем 1,5-2,5 тысяч человек. 3-15 ноября 1493 года Колумб открыл острова Доминика, Гваделупа и около 20 Малых Антильских островов, 19 ноября остров Пуэрто-Рико. В марте 1494 в поисках золота совершил военный поход в глубь острова Гаити, летом открыл юго-восточный и южный берега Кубы, острова Хувентуд и Ямайку.
В течение 40 дней Колумб обследовал южное побережье Гаити, завоевание которого продолжил в 1495 году. Но весной 1496 отплыл домой, завершив второе плавание 11 июня в Кастилии. Колумб известил об открытии нового пути в Азию. Начавшаяся вскоре колонизация новых земель вольными поселенцами обходилась испанской короне очень дорого, и Колумб предложил заселять острова уголовниками, вдвое сократив им срок наказания. С огнем и мечом, грабя и разрушая страну древней культуры, по земле ацтеков — Мексике — прошли военные отряды Кортеса, по земле инков — Перу — отряды Писарро.
Третья экспедиция Колумба (1498-1500) состояла из шести судов, три из которых он сам повел через Атлантику. 31 июля 1498 года был открыт остров Тринидад, вошел в залив Пария, обнаружил устье западного рукава дельты Ориноко и полуостров Пария, положив начало открытию Южной Америки. Выйдя в Карибское море, подходил к полуострову Арая, открыл 15 августа остров Маргарита и 31 августа прибыл на Гаити. В 1500 году по доносу Христофора Колумба арестовали и закованный в кандалы (которые потом хранил всю жизнь) был отправлен в Кастилию, где его ждало освобождение. Добившись разрешения продолжать поиски западного пути в Индию, Колумб на четырех судах (четвертая экспедиция, 1502-1504) достиг 15 июня 1502 острова Мартиника, 30 июля — Гондурасского залива, где впервые встретил представителей древней цивилизации майя, но не придал этому значения. С 1 августа 1502 по 1 мая 1503 открыл 2000 км карибских берегов Центральной Америки (до залива Ураба). Не найдя прохода к западу, он повернул на север и 25 июня 1503 потерпел крушение у берегов Ямайки. Помощь из Санто-Доминго пришла только через год. В Кастилию Колумб вернулся 7 ноября 1504 года уже тяжело больным.
Последние годы жизни
Болезнь, бесплодные и тягостные переговоры с королем о восстановлении прав, безденежье подорвали последние силы Колумба, и 20 мая 1506 он умер в Вальядолиде. Его открытия сопровождались колонизацией земель, основанием испанских поселений, жестоким порабощением и массовым истреблением отрядами конкистадоров коренного населения, названного «индейцами». Христофор Колумб не был первооткрывателем Америки: острова и побережье Северной Америки посещались норманнами за сотни лет до него. Однако только открытия Колумба имели всемирно-историческое значение. То, что он нашел новую часть света, было окончательно доказано плаванием Магеллана. Имя Колубма носят: государство в Южной Америке, провинция Канады, Федеральный округ и река в США, столица Шри-Ланки, а также множество рек, гор, озер, водопадов, мысов, городов, парков, скверов, улиц и мостов в разных странах.
Правда и вымысел в биографии Христофора Колумба
Колумб родился в бедной семье. Действительно, его семья была небогатой, но это не помешало Колумбу получить хорошее образование — по некоторым источникам, он окончил Павийский университет. Женитьба на донье Фелипе Монис де Палестрелло, скорее всего, сыграла знаковую роль, так как ее отец был знаменитым мореплавателем времен принца Энрике.
Путешественник, подаривший миру Новый Свет умер, так и не узнав, что нашел не тот континент, который искал. В те времена появилось предположение, что для того, чтобы добраться до Индии, Китая или Японии надо переплыть Атлантический океан. Вся экспедиция Колумба организовывалась именно для открытия нового прямого пути на Дальний Восток. Географ Паоло Тосканелли подсчитал, что надо проплыть 5600 км для достижения берега, что совпадало с расчетами Колумба. В результате, открыв во время первого путешествия Новый Свет, Колумб до последнего верил, что он высадился на границе с Китаем.

Колумб недолго снаряжал свою первую экспедицию.
Это не так. С того момента, как он задумал экспедицию, до ее снаряжения прошло достаточно много времени. До 1485 года Колумб служил на генуэзских и португальских судах, побывал в Ирландии, Англии, на Мадейре. В это время он кроме занятий торговлей усиленно занимался самообразованием. Он вел обширную переписку с известными учеными и картографами того времени, составлял карты, изучал судоходные маршруты. Скорее всего, именно в те году к нему пришла идея добраться до Индии западным путем. Предположительно в период с 1475-1480 гг. (точных данных нет) он отправил первое предложение купцам и правительству Генуи. Таких писем ему предстояло написать еще очень много, около 10 лет он получал только отказы. Более того, потерпев крушение у берегов Португалии, он долгое время пытался уговорить португальского короля и лишь после нескольких потерянных лет направился в Испанию. В результате он смог отправиться в первую экспедицию только в 1492 году, благодаря поддержке испанской королевы Изабеллы.

Возвращение Колумба из первой экспедиции обострило политическую ситуацию.
Когда в 1493 году Колумб вернулся, открыв новые земли, это сообщение взбудоражило умы и обострило ситуацию между Испанией и Португалией. До этого времени основным первооткрывателем всех новых путей в Африку была Португалия. Ей даровались все земли к югу от Канарских островов. Но испанский король Фердинанд и королева Изабелла не собирались отдавать права Испании на вновь открытые земли, в связи с чем, обратились к Папе Александру VI. Папа постановил, что в 600 км к западу от Азорских островов на карте нужно провести вертикальную линию (так называемый, папский мередиан), к востоку от которой все земли будут принадлежать Португалии, а к западу — Испании. Однако португальский король не согласился с этим решением, так как в этом случае португальские суда не могли плыть на юг и восток, не входя на испанскую территорию. В результате Испанцы пошли на уступки и вертикальную линию отодвинули на 1600 км к западу. Испания даже не могла представить, каким роковым окажется это решение. Буквально через 7 лет, в 1500 г. португальский мореплаватель Педру Кабрал, плывя в Индию наткнулся на сушу, не обозначенную на карте. Как выяснилось, проведенная на карте линия, отрезала этот кусок в пользу Португалии, которая сразу предъявила свои права. В результате, еще до того, как Америка была признана новым континентом, будущая Бразилия стала принадлежать Португалии.
Благодаря Колумбу, местных жителей стали называть индейцами. Колумб искал Индию и когда достиг Багамских островов, то был полностью уверен, что нашел ее. Поэтому местных жителей он стал называть индейцами. Это название закрепилось за коренными жителями до сих пор.
Вторую экспедицию Колумб сумел снарядить благодаря хвастовству. Этого никто доподлинно подтвердить не может. Но известно, что по возвращении в Барселону Колумб действительно хвастался своими достижениями. Более того, он неоднократно демонстрировал золотые украшения, добытые у местных племен, говоря при этом о богатствах индийской земли. Его тщеславие иногда возносило его так высоко, что он начинал рассуждать о будущих переговорах с Великим ханом. Поэтому совсем неудивительно, что король и королева Испании могли поддаться речам Колумба. В любом случае, они очень быстро при поддержке Папы организовали вторую экспедицию (с 1493 по 1496 гг.).
Колумб был пиратом. Это спорное суждение. Однако есть некоторые факты, которые характеризуют не лучшие его черты. В своих донесениях со второй экспедиции он просит выслать из Испании корабли со скотом, припасами, орудиями труда. Далее он пишет: «Оплату же… можно производить рабами из числа каннибалов, людей жестоких… хорошо сложенных и весьма смышленых». Это значит, что он ловил для Испании местных жителей в качестве рабов. Фактически вся его деятельность на новых землях сводилась к разбою и грабежу, что свойственно именно пиратам, хотя нельзя отрицать того, что это может быть следствием воспитания эпохи. Конечно, можно обвинить Колумба во всех дальнейших бедах американского континента, но вряд ли это будет честно. Никто не обязан отвечать за грехи других.

Колумб имел монополию на все открытые земли.
Действительно, по прибытию из первой экспедиции, Колумбу (Донну Кристовалю Колону) был присвоен титул адмирала моря — океана, вице — короля и губернатора островов, открытых в Индии. Его монополия была беспрекословной, до тех пор, пока после второй экспедиции не выяснилось, что новые территории слишком обширны и один человек не в состоянии ими править. В 1499 году короли отменили монополию Колумба на открытие новых земель. Это было связано прежде всего с тем, что в 1498 году португалец Васко да Гама доплыл по морю до настоящей Индии и начал с ней торговые отношений. На фоне его достижений, Колумб, с его усложнившимся положением, малой прибылью казне и конфликтами на новых территориях, казался лжецом. В один миг он лишился всех завоеванных привилегий.
Христофор Колумб славно завершил все три свои экспедиции. Первая экспедиция принесла Колумбу славу. Вторая, для проведения которой было выделено 17 кораблей, принесла сомнения в богатствах открытых земель. Третья экспедиция стала для Колумба роковой. Во время нее он лишился всех прав на земли. Франсиско Бобадилья, отправленный на Эспаньолу с неограниченными полномочиями, арестовал адмирала и его братьев Барталомео и Диего. Их заковали в кандалы. На Колумба кандалы набил его собственный повар. Они были посажены в Сандомингскую крепость. Колумба обвинили в «жестокосердности и неспособности управлять страной». Через два месяца их в кандалах отправили в Испанию. Лишь через два года короли сняли с Колумба обвинения. Ему были пожалованы 2000 золотых, но данное обещание вернуть ему имущество и деньги выполнено не было.
Христофора Колумба похоронили с почестями. Из четвертой экспедиции Колумб вернулся тяжело больным. Он еще надеялся отстоять свои права, но со смертью своей покровительницы — королевы Изабеллы, это надежда угасла. В конце жизни он нуждался в деньгах. В 1505 году был дан приказ о продаже всего движимого и недвижимого имущества Колумба на Эспаньоле для расплаты с кредиторами. 20 мая 1506 года великого мореплавателя не стало. Его смерти никто не заметил. Его открытия были почти забыты на фоне завоеваний португальцев. Его смерть зафиксировали только спустя 27 лет. В конце жизни все его мечты о богатстве, добытом золоте и почестях потерпели полный крах…

Хорошо знаешь историю географических открытий?

Проверь себя

Начать тест

Ваш ответ:

Правильный ответ:

Ваш резульат: {{SCORE_CORRECT}} из {{SCORE_TOTAL}}

Ваши ответы

Средневековье богато биографиями людей с удивительными судьбами. В то суровое время возможным было все: нищие становились герцогами и королями, подмастерья создавали шедевры искусства, а мечтатели открывали новые миры. Кому-то все давалось легко и играючи, а кто-то на пути к вершине был вынужден преодолевать все мыслимые и немыслимые препятствия…

Мало кто сегодня знает, что величайший из средневековых мореплавателей, легендарный Христофор Колумб может вполне заслуженно и обоснованно называться одним из крупнейших неудачников Эпохи Великих Открытий и средневековья в целом.

Почему так? Достаточно хоть немножко вчитаться в его биографию, чтобы все понять.

Самое интересное для Вас!

Итальянец на службе испанской короны

Начать следует с того, что Колумб не испанец и даже не португалец, как многие считают. Он – пылкий сын Италии, из Генуи. Именно там он родился где-то в промежутке между 26 августа и 31 октября 1451 года (а спустя 29 лет родился в Португалии ещё один известный мореплаватель Фернан Магеллан). Принято считать, что Христфор Колумб рос в небогатой семье. Но в целом о его детстве и юности известно не так много. Вообще поразительно, что в биографии настолько известного даже в свою эпоху человека, есть масса «белых пятен».

Поскольку рос будущий первооткрыватель возле самого моря, с детства он бредил именно профессией моряка. Кстати, с детства мечтал о море и адмирал Нельсон — одна из известнейших личностей Англии. Это не помешало Колумбу немного поучиться в Павийском университете, после чего он поступил на службу в генуэзский флот примерно в 1465 году. Известно, что через некоторое время после этого он получил тяжелое ранение и временно оставил море. Кстати, далее Колумб плавал исключительно под испанским и португальским флагом, а на родине оказался невостребованным.

В 1470 году Христофор женился на донье Фелипе Монис де Палестрелло, которая была дочерью видного мореплавателя тех времен. Тихо пожить почти без моря ему удалось до 1472 года в Генуе. С 1472 он объявился в Савоне, немного пожил там и перебрался в 1476 в Португалию, и снова начал активно участвовать в морских торговых экспедициях.

До самого 1485 года Колумб плавал на португальских судах, проживая, то в Лиссабоне, то на Мадейре, то на Порту-Санту. В это время он преимущественно занимался торговлей, повышением своего образовательного уровня и составлением карт. В 1483 он уже имел готовый проект нового морского торгового пути в Индию и Японию, с которым мореплаватель и отправился к португальскому королю.

Но время Колумба еще не пришло, или он не смог должным образом аргументировать необходимость снаряжения экспедиции, или по каким-то другим причинам, но монарх после двух лет раздумий отверг это предприятие, да еще и устроил дерзкому моряку опалу.

Колумб покинул его, перейдя на испанскую службу, где спустя несколько лет через череду сложных и тонких интриг ему таки удалось уговорить короля на финансирование экспедиции.

Рождение великого проекта

Никто точно не может сказать, когда именно был составлен проект западного морского пути в Индию. Ученые доказали, что в своих расчетах Колумб основывался на античных знаниях о шарообразности Земли, а также изучал выкладки и карты ученых 15 столетия. Предположительно, на саму идею шарообразности и возможности такого плавания в 1474 году его натолкнул географ Паоло Тосканелли, что подтверждено его письмом Колумбу. Мореплаватель начал производить собственные расчеты и решил, что если плыть через Канарские острова, то от них до Японии не должно быть больше пяти тысяч километров.

Совершенствованию проекта Колумба поспособствовало и посещение Англии, Ирландии и Исландии в 1477 году, где он собирал слухи и данные исландцев о том, что на западе есть обширные земли. Свое моряцкое мастерство дальних походов он отточил в 1481 году, когда плавал в Гвинею, будучи капитаном одного из судов в составе экспедиции Диогу де Азамбужа, отправленной для строительства крепости Сан-Жоржи-да-Мина. Видимо, именно после этого плавания у Колумба имелось уже не только твердое убеждение о возможности успеха своего проекта, но и была собрана неплохая доказательная база в его пользу. Оставалось только научиться уговаривать власть имущих на финансирование…

Следует отметить, что первое предложение об организации экспедиции он сделал властям и купцам родной Генуи примерно после 1476 года, однако тогда он был еще слишком молод и мог предоставить очень мало доказательств, чтобы к его мыслям отнеслись всерьез. А ведь скромная во все времена Генуя, затмеваемая Венецией и Римом, могла бы на несколько веков стать центром мира вместо Испании, ко времени экспедиции Колумба бывшей слабой и довольно бедной страной.

В 1485 году проект плавания в Индию отверг португальский король Жуан II, да так категорично, что Колумб с семьей был вынужден срочно бежать в Испанию. Как ни странно, именно это бегство стало судьбоносным для Колумба, ведь первое пристанище он нашел в монастыре Санта-Мария-да-Рабида, настоятель которого, Хуан Перес де Марчена был близким знакомым Эрнандо де Талаверы, духовника королевы. Именно через него удалось передать царствующей особе письмо с идеями Колумба. Королевская чета в это время проживала в Кордове, готовя страну и армию к войне с Гранадой, но зерно было посеяно.

Уже в 1486 году Колумб сумел зажечь своим проектом фантазию богатого и влиятельного герцога Медина-Сели, который к тому же ввел небогатого в сущности мореплавателя в круг королевских финансовых советников, банкиров и купцов. Но самым полезным стало знакомство с его дядей – испанским кардиналом Мендосой. Этот уже взялся за проект со всей серьезностью, собрав своей властью комиссию из богословов, юристов и придворных. Комиссия работала целых четыре года и ничего не дала, так как здесь Колумба подвел его характер – скрытный и недоверчивый.

В любом случае с 1487 по 1492 Колумб не столько плавает, сколько путешествует по Испании вслед за Королевской четой. В 1488 он получил от португальского короля приглашение к возвращению в Португалию, но было уже поздно – Колумб почувствовал, что здесь, в Испании, он точно чего-то добьется. Впрочем, письма со своими предложениями он разослал всем влиятельным дворам Европы, но ответ получил только от английского короля Генриха VII, который в 1488 году выразил мореплавателю свою поддержку, но ничего конкретного не предложил. Кто знает, быть может, будь на троне в то время Генрих VIII, сын Генриха VII, Христофор Колумб ушел бы в экспедицию под флагом Англии. Генрих VIII очень любил флот, чего только стоило ему создание огромных кораблей по тем меркам Великий Гарри и Мэри Роуз !

Испанцы же хотели организовать экспедицию, но страна пребывала в затяжной войне и средства на плавание выделить не удавалось. В 1491 году Колумб в Севилье снова лично встретился с Фердинандом и Изабеллой, но безрезультатно – денег и помощи не дали. В январе 1492 Гранада пала, Испания завершила войну, и Колумб имел возможность практически сразу добиться организации экспедиции, но его снова подвел характер! Требования моряка были непомерными: назначение вице-королем всех новых земель, титул «главного адмирала моря-океана» и очень много денег. Король отказал.

Спасла положение королева Изабелла, которая отговорила Колумба от эмиграции во Францию и пригрозила заложить свои фамильные драгоценности для организации экспедиции. В итоге было составлено предприятие, по которому один корабль давало государство, один – сам Колумб, а один – Мартин Алонсо Пинсон, снарядивший «Пинту». Кроме того, этот магнат одолжил денег Колумбу, который по договору должен был взять на себя восьмую часть расходов по экспедиции.

30 апреля 1492 года король официально пожаловал Христофору Колумбу титул «дон», сделав его дворянином, а также подтвердил все требования дерзкого моряка, вплоть до звания вице-короля всех новооткрытых земель и передачи его по наследству.


Экспедиции Христофора Колумба

Первая экспедиция Колумба состоялась 3 августа 1492 года и была небольшой – около 90 человек на трех кораблях – «Санта-Марие», «Пинте» и «Нинье», отправилась в путь из Палоса. Дойдя до Канарских островов, она повернула на запад, по небольшой диагонали пересекла Атлантику, по пути открыв Саргассово море. Первой увиденной землей стал один из островов Багамского архипелага, названный Сан-Сальвадором. Колумб высадился на нем 12 октября 1492 года и этот день стал официальной датой открытия Америки .

Примечательно, что до 1986 года географы и историки точно не знали, какой из островов именно открыл Колумб первым, пока географ Дж. Джадж не доказал, что это был остров Самана. В последующие дни Колумб открыл еще ряд Багамских островов, а 28 октября прибился к побережью Кубы. Уже 6 декабря он увидел Гаити и двинулся вдоль северного берега. Там 25 декабря «Санта-Мария» села на риф, хотя экипаж удалось спасти.

Именно после крушения «Санта-Марии», когда морякам пришлось потесниться на оставшихся судах, Колумб приказал вместо коек установить для матросов гамаки, подсмотрев эту идею у туземцев. Так удалось компактно размещать больше людей, а сам способ настолько прижился, что ушел в небытие только столетие назад.

В марте 1493 года оставшиеся суда вернулись в Кастилию. Они привезли немного золота, несколько туземцев, диковинные растения и перья птиц. Колумб заявил, что открыл западную Индию. Прочитав про первую экспедицию Кука , любознательные могут сравнить успехи Колумба и Джеймса Кука на этапах их ранних карьер. Разница между этими экспедициями 275 лет!

Вторая экспедиция отправилась в путь в том же 1493 году. Колумб ее возглавил уже в чине адмирала и вице-короля всех открытых земель. Это было грандиозное предприятие, в котором участвовали 17 крупных судов и более 2000 человек, среди которых были и священники, и чиновники, а также юристы, ремесленники и солдаты. В ноябре 1493 года была открыта Доминика, Гваделупа и Антильские острова. В 1494 экспедиция обследовала острова Гаити, Кубу, Хувентуд и Ямайку, но золота там нашлось очень мало.

Весной 1496 Колумб отправился домой, завершив путешествие 11 июня. Эта экспедиция открыла путь колонизации, после нее в новые земли начали отправлять поселенцев, священников и преступников, которые оказались самым дешевым способом заселения новых колоний.

Третья экспедиция Колумба началась в 1498 году. Она состояла всего из шести судов и была исключительно исследовательской. 31 июля он открыл Тринидад, нашел залив Пария, обнаружил устье Ориноко и полуостров Пария, наконец добравшись до континента. Забравшись немного дальше Колумба, в богатые земли Южной Америки вторглись завоеватели Эрнана Кортеса и Клаудио Писарро. 15 августа был открыт остров Маргарита, после чего мореплаватель прибыл на Гаити, где уже действовала колония испанцев.

В 1500 году Колумба по доносу арестовали и отправили в Кастилию. Впрочем, там он просидел не очень долго, зато свои кандалы сохранил на всю жизнь. Получив свободу, Колумб все же был лишен большинства привилегий и большей части богатства. Так, вице-императором он больше не стал, и это было самым главным разочарованием заключительной части жизни мореплавателя. От третьей экспедиции Колумб испытал разочарование, но остался жив, а вот третья экспедиция Кука стала для путешественника последней.

Четвертая экспедиция началась в 1502 году и проводилась всего на четырех кораблях. 15 июня он вышел на траверз Мартиники, а 30 июля – вошел в Гондурасский залив, где впервые вступил в контакт с представителями государства майя. В 1502-1503 годах Колумб тщательно исследовал берега Центральной Америки в поисках заветного прохода на запад, ведь сказочные богатства Америки еще не были обнаружены и все жаждали добраться до Индии. 25 июня 1503 года Колумб потерпел крушение возле Ямайки, и был спасен только год спустя. В Кастилию мореплаватель попал 7 ноября 1504 года, тяжело больным и расстроенным неудачами. На этом его эпопея завершилась. Не найдя заветный проход в Индию, оставшись без прав и денег, Христофор Колумб умер в Вальядолиде 20 мая 1506 года. Его заслуги были оценены гораздо позже, спустя столетия, а для своей эпохи он остался просто одним из мореплавателей, отправляющихся в дальние страны.


Характер Христофора Колумба

У великих людей не бывает простого характера. Это же можно сказать про Колумба, и именно это во многом стало причиной его краха в конце жизненного пути. Христофор Колумб был страстным мечтателем, фанатом своей идеи и цели, которым прослужил всю жизнь. Одновременно с этим историки и современники характеризуют его как алчного, неумеренно властного человека, который всю жизнь мечтал быть выше других. Неумеренные желания не позволили ему остаться на вершине богатства и знатности, но все же он прожил выдающуюся жизнь, совершив выдающиеся деяния!

Трагедия Христофора Колумба

Если всмотреться глубже, можно понять, что умирал Колумб несчастным человеком. Он не добрался до сказочно богатой Индии, а ведь именно это, а не открытие нового континента, было его целью и мечтой. Он даже не понимал, что открыл, и впервые увиденные им континенты получили имя совсем другого человека – Америго Веспуччи, который просто немножко продлил проторенные Колумбом тропы. Фактически Америку открыли норманны еще несколько веков до него, так что и здесь мореплаватель не стал первым. Он достиг многого, и одновременно не достиг ничего. И это его трагедия.

Мир после Колумба вступил в Эпоху Великих Открытий, а до него Европа была нищей, голодной и постоянно воюющей за невеликие ресурсы, не помышлявшей о мировом господстве. Достаточно вспомнить, как тяжело Колумбу далась организация своей первой экспедиции, и с какой легкостью все страны кинулись отправлять корабли в дальние края после него. Это и есть главная историческая заслуга человека, несчастного лично, но давшего толчок изменению всего мира!

zkzakhar

Христофор Колумб (краткая биография и открытия)

Испанский мореплаватель итальянского происхождения Христофор Колумб – культовая фигура в мировой истории и мореплавании. Открытия, сделанные им, изменили представления ученых о географии, планете, способствовали началу эпохи Великих географических открытия. Следствиями плаваний Колумба стало налаживание торговли между Европой и Азией, открытие новых культур и народов, начало колониальной политики европейских государств, распространение власти Испании за пределы Иберийского полуострова.

Происхождение Колумба

Мореплаватель родился 1 октября 1451 г. в Генуе в семье Доминико Коломбо и Сюзанны Фонтанаросса. Отец Христофора был хранителем городских ворот, а также занимался ткачеством и суконным делом. В Генуе сохранился дом, где родился Колумб и где долгое время работал старший Колумб.

Историки считают, что родословная мореплавателя гораздо обширнее, чем представляется на первый взгляд. Некоторые ученые причисляют Колумба к испанцам или итальянцам, другие – к португальцам, третьи – к грекам. Есть даже версия, что семья Колумба имеет иудейские корни. Подобные выводы историки делают на основании различных источников и воспоминаний современников, точных подтверждений той или иной версии нет. Установить точно, кем по национальности был Колумб, пока не представляется возможным. Он отлично писал и говорил по-испански, при этом отчетливо слышался диалект, который есть в жителей Португалии. Знал Христофор латынь, итальянский, греческий.

Семья

У Колумба было четверо братьев, с которыми он занимался, поскольку был самым старшим ребенком в семье. Особого образования у мореплавателя не было. Закончив основное обучение, он стал много путешествовать на торговых кораблях. В середине 1470-х гг. попал в Португалию, где решил начать собственное дело. Занялся Колумб со своим братом Бартоломеем картографией, которая в то время активно развивалась.

В Португалии он женился на Фелипе Монис де Палестрелло, которая была дочерью губернатора этой страны. Бракосочетание состоялось в 1479 г., через год родился их сын, которого называли Диего. Колумб перевез жену в Геную, а сам и дальше продолжал путешествовать. Наконец-то он «пускает» корни в Испании, находит работу в монастыре, заводит роман с другой женщиной. И в это же время ему приходит идея о том, что надо найти Америку. Точно не установлено, когда умерла донья Фелипа. Скорей всего, смерть к ней пришла уже после того, как Колумб доплыл до Америки. По другой же версии, жена мореплавателя умерла до его первого плавания.

Второй супругой Колумба стала Беатрис Энрикес де Арана. В этом браке также родился сын, получивший имя Фернандо. Умер адмирал в 1506 г. в испанском городе Вильядолиде. Его здоровье было подорвано многочисленными плаваниями, вирусами и незнакомыми болезнями, которые он подхватывал на открытых островах. Кроме того, он длительное время безуспешно пытался добиться наследственных прав для себя и своих детей на некоторые открытые территории.

Личные качества

Колумб был довольно религиозным, всю жизнь верил в проведение и различные предзнаменования. Одновременно с этим мореплаватель был практичным, подозрительным, любил золото и богатство, болезненно реагировал на критику. Острый ум, широкие познания в различных сферах и дар убеждения помогали ему добиваться того, чего он хотел. В частности, Х. Колумб смог красноречиво доказать правителям Испании, что финансирование его экспедиции, принесет им славу и сделает Испанию великой морской державой.

Экспедиции

К концу 15 в. люди уже накопили достаточное знаний, чтобы не верить в версию про плоскость Земли. Колумб много читал античные сочинения, где говорилось о том, что планета шарообразная. Скорей всего, проект морской компании об открытии пути в Индию созревал постепенно. Х. Колумб делал расчеты, основываясь на неправильных расчетах, сделанные в 15 в.

Впервые мореплаватель заговорил об экспедиции к Индии в 1485 г., и с этой идеей пошел к португальскому королю. Но при дворе ему отказали, и он решил перебраться в Кастилию. Здесь купцы и банкиры из Андалусии помогли организовать путешествие в дальние страны.

В это же время испанские правители Изабелла и Фердинанд дали согласие на финансирование плавания в Индию. Первая экспедиция продлилась с 1492 по 1493 гг. В 1492 г. из города Палоса вышли три каравеллы – Нинья, Пинта и Санта-Мария, на которых было 90 человек экипажа и помощников Колумба. Во время первого плавания были открыты:

  • Остров Самана.
  • Саргассово море.
  • Багамы.
  • Куба и ее северо-восточное побережье.
  • Гаити – Колумб прошел вдоль северного берега.

Глава Ватикана после открытий, сделанными Колумбом, провел по Атлантическому океану так называемую демаркационную линию – папский меридиан. Так были обозначены разные векторы внешней политики Португалии и Испании, которые касались открытия новых земель. Испанские правители присвоили мореплавателю должности адмирал и вице-король открытых территорий, и согласились выделить средства для второго плавания. Оно продлилось с 1493 по 1496 гг., и по количественным характеристикам отличалось от первого. Во-первых, в подчинении адмирала находилось 17 кораблей. Во-вторых, численность экипажа достигала 2,5 тыс. человек.

Экспедиция исследовала Гаити, где был проведен военный поход для поиска золота, а также открыты:

  • Острова – Гваделупа, Доминикана, Малые Антильские, Поэрто-Рико, Ямайка, Хувентуд.
  • Южные берега Кубы и Гаити.

После второго плавания Колумб отчитывался перед государями Испании и утверждал, что нашел новый путь в Азию. Новые земли были провозглашены собственностью испанской короны. Началась их колонизация, на территории и острова перевозили уголовников, поскольку вольные поселенцы не хотели работать в колониях. Последствия были печальными – разрушены, разграблены, а потом и уничтожены древние империи ацтеков, инков, майя.

Третье плавание длилось с 1498 по 1500 гг., в которое отправилось 6 кораблей. Половина судов во главе с Колумбом прошли через Атлантику. В результате этого путешествия мореплаватель вышел к берегам Южной Америки, обследовав Тринидад, залив и полуостров Пария, реку Ориноко. К 1500 г. экспедиция доплыла к Гаити, здесь адмирала арестовали и отправили в Кастилию. Тут его оправдали и освободили, после чего Колумб стал снова готовиться к дальним странствиям. Ему не давало покоя то, что в течение стольких лет, не был найден западный путь в Индию.

Выпросив у королей деньги, адмирал нанял четыре корабля и отправился в путь. В течение 1502-1504 гг. под испанскую корону перешли новые земли. Среди них остров Мартиника, Гондурасский залив, протяженный берег Южной Америки, омываемый Карибское море. В 1503 г. корабли потерпели крушение у Ямайки. Колумб запросил помощь с острова Санто-Доминго, которая поспела только через год. Ремонт судов позволил адмиралу попасть в Кастилию, куда он добрался в ноябре 1504 г. В это время Христофор Колумба был больным.

Значение экспедиций

Земли, которые во время плаваний с 1492 по 1504 г. на карты наносил Колумб и ученые, которые плавали вместе с ним, способствовали активному развитию географической науки, навигации, мореплаванию. Это дало толчок к пересмотру взглядов на континенты и водное пространство Земли. Научные открытия шли «в ногу» с развитием техники и кораблестроения. Колумб не был первым, кто нашел для европейцев Североамериканский континент. Ранее в 8-9 вв. это сделали викинги. Только Магеллан доказал, что Х. Колумб нашел Америку, которая находилась в новой части света, незнакомая до 15 в. жителям Европы. Экспедиции Колумба способствовали изменению европейской торговли, в которой появились новые направления. Испания стала монополистом многих товаров и услуг, контролируя атлантические торговые пути. Благодаря постоянным открытиям, были построенные новые населенные пункты в основанных колониях.

Но не только положительные результаты принесли открытия адмирала. Было много и отрицательных последствий, среди которых стоит отметить:

  • Испанская колонизация земель и создание там новых поселений.
  • Жестокое обращение с индейцами Южной, Центральной и Северной Америк, а также с туземными племенами открытых островов. Многие государства были полностью уничтожены, а население истреблено.
  • Уничтожение материальной и духовной культуры.
  • Грабеж империй майя, инков и ацтеков.
  • Были заложены основы работорговли и превращения туземцев в рабов.
  • Разрушены традиционные связи народов на островах, в Северной и Центральной Америке.

Кто помнит о Колумбе?

В различных странах мира чтят память об адмирале и мореплавателе. В частности, в Южной Америке его именем названа страна – Колумбия. Есть одноименная провинция в Канале, река и округ в Соединенных Штатах. Столица островного государства Шри-Ланка называется Коломбо.

Природным объектам также присвоено имя Колумба, как и административных единиц. В частности, улицы, города, парки, скверы и мосты во многих государствах мира.

Памятник открывателю Индии стоит в Барселоне, который появился в городе в конце 1880-х гг.

О мореплаваниях Колумба сняты фильмы, сериалы, о нем рассказывают в документальных кинолентах. Кроме того, ученые постоянно изучают его жизнь и деятельность, находя в архивах новые документы о морских экспедициях, поступках в колониях, семье.

Интересные факты биографии мореплавателя

  • До конца жизни считал, что доплыл к восточному берегу Азии. На самом же деле Колумб высадился в 15 тыс. км от него, выйдя к Индии.
  • Мореплаватель долгие семь лет уговаривал Фердинанда и Изабеллу, доказывая им, что океанская экспедиция принесет лавры Испании. Правители не верили незнакомому человеку, картографу и торговцу, который был незнаком испанскому обществу. Научные мужи того времени говорили о том, что поиск западного пути в Индию является авантюрой. Они просто не понимали, как можно плыть на запад, чтобы открыть новые земли. Находясь с 1485 г. в Испании, Колумб попал на прием к Фердинанду с Изабеллой только через 6 лет.
  • Первый экипаж для кораблей, которые должны были отправиться в путь в 1492 г., формировали из уголовников. Никто другой не хотел пускаться в незнакомое плавание с человеком, в чью идею не верили ученые и которому едва доверяли монархи.
  • Моряки во время первой экспедиции не знали точно, куда они плывут, какие расстояние им предстоит пройти. Экипаж воспринимал китов, альбатросов или водоросли в качестве признаков приближающейся земли. Колумб не говорил матросам, сколько корабли проходили за сутки. Люди долгое время не видели землю, поэтому с каждым днем их охватывала паника.
  • Колумб первым в мире увидел, что на компасе магнитная стрелка стала отклоняться от своего значения. В то время моряки и ученые верили в то, что магнитная стрелка должна показывать строго на Полярную звезду, а она все больше и больше отклонялась от нужного направления. Об этом наблюдении никто не знал, поскольку Колумб боялся, что это вызовет среди членов экипажа панику.
  • Жителей открытых земель и островов мореплаватель называл индейцами, название прижилось и используется сегодня.
  • Колумб в Европу привез новые виды продуктов, специи, лошадей и коров. Ни животные, ни продукты не были известны на континенте. Так в Испанию доставили картофель, помидоры, кукурузу и виноград. Европейцам довольно быстро оценили пользу животных и новых культур, что способствовало становлению нового торгового обмена между Европой и Америкой. Этот процесс стали называть Колумбов обмен.
  • Право называться родиной мореплавателя оспаривают 6 городов Италии и Испании.
  • На Багамских островах моряки и адмирал познакомился с новой культурой, которая пользовалась у туземцев популярностью. Новая трава, которую Колумб прихватил с собой в Испанию, называлась табак.
  • У Колумба были проблемы с монархами из-за того, что он не привез с плавания богатства, пряности, специи и драгоценные металлы. Вместо этого с берегов Кубы, Тортугу и Гаити были доставлены экзотические фрукты, растения, перья птиц и туземцы.
  • Путь в Индию был найден еще при жизни Колумба, когда в 1498 г. Васко да Гама достиг берегов этой страны.

Интересной является судьба останков Колумба, которые из Испании перевезли на Гаити. Когда испанцы ушли с острова, то прах великого мореплавателя перевезли в Гавану, п оттуда – в Санта-Доминго, а затем – Севилью. Долгое время считалось, что останки покоятся в кафедральном соборе, но генетические исследование доказали обратное. Было установлено, что кости принадлежат другом человеку в возрасте 45 лет. Колумбу же на момент смерти было около 60 лет. Где находятся сейчас останки мореплавателя, никто из историков не знает.



(3 оценок, среднее: 5,00 из 5)
Для того чтобы оценить запись, вы должны быть зарегистрированным пользователем сайта. Загрузка…

МГУ им. адм. Г.И. Невельского

3 июля 2009 года
Что мы знаем о Колумбе?

29 апреля с. г. на сайте МГУ уже было сообщение о поступившей в музей МГ У на реставрацию модели каравеллы Христофора Колумба «Санта-Мария».

Ничуть не умаляя географических открытий отечественных и зарубежных первооткрывателей прошлых веков, мне хотелось бы поведать читателям и об этом великом мореплавателе, ведь он три четверти своей жизни провел в море! Сегодня мы продолжаем свой рассказ об этом неутомимом итальянце.

Христофор Колумб родился в Генуе в 1451 г. Используя знания об античном учении о шарообразности земли, он создал проект западного, как он считал, кратчайшего, морского пути из Европы в Индию. Живя в 1476 – 1484 гг. в Португалии, пытался заинтересовать португальского короля в организации экспедиции в Индию, но не получил от него поддержки. Вернувшись в Кастилию, Колумб сумел с помощью андалусских купцов и банкиров организовать свое первое плавание по намеченному уже давно маршруту.

3 августа 1492 г. 90 человек на трех каравеллах: «Санта-Мария», «Пинта» и «Нинья» — вышли из г. Палос и 9 сентября, достигнув Канарских островов, повернули на запад, далее, пройдя через Атлантический океан в районе субтропиков, 12 октября 1492 г. достигли острова Сан-Сальвадор в Багамском архипелаге (официальная дата открытия Америки). Затем были обследованы и другие острова Багамов, открыта Куба и острова Гаити. К сожалению, в ночь на 25 декабря флагманская каравелла «Санта-Мария» села на рифы и погибла, а Колумб с командой был вынужден перебраться на «Нинью».

15 марта 1493 г. экспедиция вернулась в Кастилию.

В 1493 – 1496 гг. Х. Колумб совершил вторую экспедицию, уже будучи в чине адмирала и вице-короля вновь открытых им земель. На этот раз экспедиция была грандиозной: 17 судов и 1,5 тысячи человек экипажей. В ноябре 1493 г. были открыты острова Доминика и Гваделупа, далее — около 20 малых Антильских островов, архипелаг Хардинес-де-ла-Рейна, полуостров Сапата и о. Пинос. 11 июня 1496 г. экспедиция с триумфом вернулась в Кастилию.

В 3-ей экспедиции (1498 – 1500 гг.) были открыты остров Тринидад, устье реки Ориноко и о. Маргарита. Закончился этот поход арестом Колумба по ложному доносу, но позднее он был полностью оправдан и освобожден.

В 1502 – 1504 гг. Колумб предпринял еще одну попытку поиска западного пути в Индию. С 1 августа 1502 г. по 1 мая 1503 г. им были открыты карибские берега Гондураса, Никарагуа, Коста-Рики и Панамы. Но 25 июня 1503 г., после поворота на север, судно потерпело крушение и Колумбу со своими людьми пришлось ждать помощи из Санта-Доминго целый год. В связи с этими событиями экспедиция закончилась только 7 ноября 1504 г.

Следует признать, что все открытия Колумба сопровождались колонизацией новых земель, основанием испанских поселений в Америке и жестоким уничтожением и порабощением коренного населения, которое Колумб назвал индейцами. Но так в те далекие времена поступали во всем мире.

Открытия Христофора Колумба, безусловно, способствовали пересмотру средневекового мировоззрения и поэтому имели всемирно-историческое значение. Умер Х. Колумб 20 мая 1506 г. в г. Вальядолида и был похоронен с почестями.

В США с большим уважением относятся к памяти о великом первооткрывателе Америки. Во многих городах можно увидеть его скульптуры и барельефы. Работая более двух десятков лет в ДВМП, мне, как и любому моряку, приходилось бывать во многих обычных и экзотических уголках мира, в том числе неоднократно и в Сан-Франциско, «Фриско», как называют его коренные жители. На одном из холмов, называемом «Русская горка», т.к. там живут выходцы из России, стоит великолепная бронзовая скульптура Колумба. Я дотронулся до его мизинца и сфотографировался на память. Так состоялось мое «знакомство» с великим мореплавателем и открывателем новых земель.

В настоящее время модель флагманской каравеллы Х. Колумба «Санта-Мария» полностью отреставрирована, закреплена на новом большом подиуме и закрыта прозрачной защитой. Теперь модель выступит в своей новой ипостаси, как приз Е.И. Жукова юнгам из «Центра начальной морской подготовки», занявшим 1-е место в гребно-парусной регате МГУ им. адм. Г.И. Невельского. Именно об этом долго мечтал организатор школы юнг «Юный мореход», преподаватель-парусник, многие годы бессменный организатор и главный судья училищных, а затем и университетских гребно-парусных регат Евгений Иванович Жуков. Сейчас модель находиться в музее МГУ и любой может вдоволь полюбоваться этим изящным творением человеческих рук.

Г.А. Воронин,
заместитель начальника ЦПВ

3 июля 2009 года


Сообщение по географии на тему «Христофор Колумб» 5 класс

  • Доклады
  • Люди
  • Христофор Колумб

Христофор Колумб родился в 1451 году. Христофор был старшим ребёнком. Семья его была не богатой. Его отец работал на пастбищах, виноградниках, а также торговал вином и сыром. Однако, несмотря на плачевное финансовое положение, он сумел получить хорошее образование. Он рос возле моря, и оно с детства влекло его. Христофор был очень красноречив и обладал разносторонними знаниями.

Существует множество портретов Колумба, написанных после его смерти. Изучив их можно сделать вывод, что он был высоким человеком. Также у него была белая кожа, орлиный нос, и серо-голубые глаза.

После учёбы в Павийском Университете, он стал работать матросом и плавать на торговых судах. После тяжёлого ранения ему пришлось оставить службу. Женившись на донье Фелипе Монис де Палестрелло, Колумб стал членом богатой итало-португальской семьи.

После окончания войны в 1492 году, Колумбу удалось получить разрешение на организацию экспедиции. Однако требования его были очень высоки. Он потребовал огромную сумму денег, а также назначение вице-королём новых земель. Король не удовлетворил его требования, однако спустя полгода король утвердил его требования.

Колумб совершил четыре исследовательские экспедиции, которые описал в бортовом журнале. Копия данного журнала дошла до наших дней. Именно благодаря ей известны многие детали путешествия.

Первая экспедиция продлилась 7 месяцев. Цель её была найти самый короткий морской путь в Индию. В ней принимали участие 90 человек. В октябре 1942 года мореплаватель с командой высадился на одном из о-ов Багамского архипелага. Именно 12 октября принято считать датой открытия Америки.

В 1493 году, Колумб в чине адмирала совершил второе путешествие. В экспедиции приняло участие более 2 тыс. человек. В результате были открыты Гваделупа, Доминика и Антильские о-ва.

В 1498 году стартовалатретья исследовательская экспедиция. В данной экспедиции было задействовано 6 судов. В 1500 году мореплаватель был арестован за донос. Просидел в заключении он не долго, однако лишился большей части своего состояния и привилегий.

Во время четвёртой экспедиции Колумб потерпел крушение. Спустя год больным и сломленным он вернулся в Кастилию, где и умер в 1506 году.

Происхождение Колумба

Мореплаватель родился 1 октября 1451 г. в Генуе в семье Доминико Коломбо и Сюзанны Фонтанаросса. Отец Христофора был хранителем городских ворот, а также занимался ткачеством и суконным делом. В Генуе сохранился дом, где родился Колумб и где долгое время работал старший Колумб.

Историки считают, что родословная мореплавателя гораздо обширнее, чем представляется на первый взгляд. Некоторые ученые причисляют Колумба к испанцам или итальянцам, другие – к португальцам, третьи – к грекам. Есть даже версия, что семья Колумба имеет иудейские корни. Подобные выводы историки делают на основании различных источников и воспоминаний современников, точных подтверждений той или иной версии нет. Установить точно, кем по национальности был Колумб, пока не представляется возможным. Он отлично писал и говорил по-испански, при этом отчетливо слышался диалект, который есть в жителей Португалии. Знал Христофор латынь, итальянский, греческий.

Интересные данные из жизни первооткрывателя

Конечно, уникальной и очень познавательной информации масса. Но в данной статье мы бы хотели привести в качестве примера самые занимательные факты.

  • Когда Христофор жил в Севилье, он дружил с гениальным Америго Веспуччи.
  • Король Жуан II сначала отказал Колумбу в организации экспедиции, но затем отправил своих моряков в плавание по предложенному Христофором маршруту. Правда, по причине сильного шторма португальцам пришлось вернуться домой ни с чем.
  • После того как Колумба заковали в кандалы, во время третьей экспедиции, он решил хранить цепи в качестве талисмана всю оставшуюся жизнь.
  • По приказу Христофора Колумба впервые за историю мореходства в качестве матросских коек использовались индейские гамаки.
  • Именно Колумб предложил испанскому королю для экономии заселять новые земли преступниками.

Семья

У Колумба было четверо братьев, с которыми он занимался, поскольку был самым старшим ребенком в семье. Особого образования у мореплавателя не было. Закончив основное обучение, он стал много путешествовать на торговых кораблях. В середине 1470-х гг. попал в Португалию, где решил начать собственное дело. Занялся Колумб со своим братом Бартоломеем картографией, которая в то время активно развивалась.

В Португалии он женился на Фелипе Монис де Палестрелло, которая была дочерью губернатора этой страны. Бракосочетание состоялось в 1479 г., через год родился их сын, которого называли Диего. Колумб перевез жену в Геную, а сам и дальше продолжал путешествовать. Наконец-то он «пускает» корни в Испании, находит работу в монастыре, заводит роман с другой женщиной. И в это же время ему приходит идея о том, что надо найти Америку. Точно не установлено, когда умерла донья Фелипа. Скорей всего, смерть к ней пришла уже после того, как Колумб доплыл до Америки. По другой же версии, жена мореплавателя умерла до его первого плавания.

Второй супругой Колумба стала Беатрис Энрикес де Арана. В этом браке также родился сын, получивший имя Фернандо. Умер адмирал в 1506 г. в испанском городе Вильядолиде. Его здоровье было подорвано многочисленными плаваниями, вирусами и незнакомыми болезнями, которые он подхватывал на открытых островах. Кроме того, он длительное время безуспешно пытался добиться наследственных прав для себя и своих детей на некоторые открытые территории.

Последние годы жизни

Последняя экспедиция подкосила здоровье великого исследователя. Остаток жизни его был омрачен тяжелым, неизлечимым заболеванием. Знакомые и друзья Христофора даже какой-то промежуток времени не знали о смерти путешественника.

Существует мнение, что похоронен известный мореход в городе Вальядолиде. Где же конкретно находится место его захоронения — до сих пор точно неизвестно.

По информации историков-биографов, перед смертью Колумб завещал поместить его останки в Картезианский монастырь в Севилье. Но, руководствуясь просьбой жены, в 1542 году останки Кристобаля переместили в город Санто-Доминго, что в Доминиканской Республике.

Не так давно в Санто-Доминго при проведении строительных работ был обнаружен свинцовый сундук с надписью: «Прославленный и уважаемый дон Кристобаль Колон». В нем оказались фрагменты костей. Однако по-прежнему никто не берется утверждать их подлинность.

Личные качества

Колумб был довольно религиозным, всю жизнь верил в проведение и различные предзнаменования. Одновременно с этим мореплаватель был практичным, подозрительным, любил золото и богатство, болезненно реагировал на критику. Острый ум, широкие познания в различных сферах и дар убеждения помогали ему добиваться того, чего он хотел. В частности, Х. Колумб смог красноречиво доказать правителям Испании, что финансирование его экспедиции, принесет им славу и сделает Испанию великой морской державой.

Четвертое путешествие к американским берегам

Что же продолжало волновать такого неугомонного человека, как Колумб? Христофор, Америка для которого уже была практически пройденным этапом, хотел отыскать новый путь оттуда в Южную Азию. Путешественник верил, что такой маршрут существует, ибо наблюдал у берегов о. Кубы сильное течение, которое шло на запад через Карибское море. В результате он смог убедить короля дать разрешение на новую экспедицию.

В свою четвертую поездку Колумб отправился вместе с братом Бартоломео и своим 13-летним сыном Эрнандо. Ему посчастливилось открыть материк к югу от о. Кубы — берег Центральной Америки. И Колумб первым сообщил Испании об индейских народах, населяющих побережье Южного моря.

Но, к сожалению, пролив в Южное море он так и не нашел. Пришлось вернуться домой практически ни с чем.

Экспедиции

К концу 15 в. люди уже накопили достаточное знаний, чтобы не верить в версию про плоскость Земли. Колумб много читал античные сочинения, где говорилось о том, что планета шарообразная. Скорей всего, проект морской компании об открытии пути в Индию созревал постепенно. Х. Колумб делал расчеты, основываясь на неправильных расчетах, сделанные в 15 в.

Впервые мореплаватель заговорил об экспедиции к Индии в 1485 г., и с этой идеей пошел к португальскому королю. Но при дворе ему отказали, и он решил перебраться в Кастилию. Здесь купцы и банкиры из Андалусии помогли организовать путешествие в дальние страны.

В это же время испанские правители Изабелла и Фердинанд дали согласие на финансирование плавания в Индию. Первая экспедиция продлилась с 1492 по 1493 гг. В 1492 г. из города Палоса вышли три каравеллы – Нинья, Пинта и Санта-Мария, на которых было 90 человек экипажа и помощников Колумба. Во время первого плавания были открыты:

  • Остров Самана.
  • Саргассово море.
  • Багамы.
  • Куба и ее северо-восточное побережье.
  • Гаити – Колумб прошел вдоль северного берега.

Глава Ватикана после открытий, сделанными Колумбом, провел по Атлантическому океану так называемую демаркационную линию – папский меридиан. Так были обозначены разные векторы внешней политики Португалии и Испании, которые касались открытия новых земель. Испанские правители присвоили мореплавателю должности адмирал и вице-король открытых территорий, и согласились выделить средства для второго плавания. Оно продлилось с 1493 по 1496 гг., и по количественным характеристикам отличалось от первого. Во-первых, в подчинении адмирала находилось 17 кораблей. Во-вторых, численность экипажа достигала 2,5 тыс. человек.

Экспедиция исследовала Гаити, где был проведен военный поход для поиска золота, а также открыты:

  • Острова – Гваделупа, Доминикана, Малые Антильские, Поэрто-Рико, Ямайка, Хувентуд.
  • Южные берега Кубы и Гаити.

После второго плавания Колумб отчитывался перед государями Испании и утверждал, что нашел новый путь в Азию. Новые земли были провозглашены собственностью испанской короны. Началась их колонизация, на территории и острова перевозили уголовников, поскольку вольные поселенцы не хотели работать в колониях. Последствия были печальными – разрушены, разграблены, а потом и уничтожены древние империи ацтеков, инков, майя.

Третье плавание длилось с 1498 по 1500 гг., в которое отправилось 6 кораблей. Половина судов во главе с Колумбом прошли через Атлантику. В результате этого путешествия мореплаватель вышел к берегам Южной Америки, обследовав Тринидад, залив и полуостров Пария, реку Ориноко. К 1500 г. экспедиция доплыла к Гаити, здесь адмирала арестовали и отправили в Кастилию. Тут его оправдали и освободили, после чего Колумб стал снова готовиться к дальним странствиям. Ему не давало покоя то, что в течение стольких лет, не был найден западный путь в Индию.

Выпросив у королей деньги, адмирал нанял четыре корабля и отправился в путь. В течение 1502-1504 гг. под испанскую корону перешли новые земли. Среди них остров Мартиника, Гондурасский залив, протяженный берег Южной Америки, омываемый Карибское море. В 1503 г. корабли потерпели крушение у Ямайки. Колумб запросил помощь с острова Санто-Доминго, которая поспела только через год. Ремонт судов позволил адмиралу попасть в Кастилию, куда он добрался в ноябре 1504 г. В это время Христофор Колумба был больным.

Популярные темы сообщений

  • Город Симферополь
    На реке Салгир, по приказу Екатерины II, граф Григорий Потемкин, в 1784 году заложил город, который получил название Симферополь. Город располагается в центре полуострова Крым.
  • Город Махачкала
    Махачкала — столица Дагестана, город в котором проживают очень отзывчивые и гостеприимные люди. Численность населения на сегодняшний день составляет более 600 000 тысяч человек. Большую часть населения занимают молодые семьи.
  • Планета Венера
    На втором месте по отдаленности от Солнца, в Солнечной системе расположилась планета Венера. Несмотря на то, что планета долгие годы не была досконально изучена, она всегда манила любопытных. Ее легко было обнаружить на ночном небосклоне.

Значение экспедиций

Земли, которые во время плаваний с 1492 по 1504 г. на карты наносил Колумб и ученые, которые плавали вместе с ним, способствовали активному развитию географической науки, навигации, мореплаванию. Это дало толчок к пересмотру взглядов на континенты и водное пространство Земли. Научные открытия шли «в ногу» с развитием техники и кораблестроения. Колумб не был первым, кто нашел для европейцев Североамериканский континент. Ранее в 8-9 вв. это сделали викинги. Только Магеллан доказал, что Х. Колумб нашел Америку, которая находилась в новой части света, незнакомая до 15 в. жителям Европы. Экспедиции Колумба способствовали изменению европейской торговли, в которой появились новые направления. Испания стала монополистом многих товаров и услуг, контролируя атлантические торговые пути. Благодаря постоянным открытиям, были построенные новые населенные пункты в основанных колониях.

Но не только положительные результаты принесли открытия адмирала. Было много и отрицательных последствий, среди которых стоит отметить:

  • Испанская колонизация земель и создание там новых поселений.
  • Жестокое обращение с индейцами Южной, Центральной и Северной Америк, а также с туземными племенами открытых островов. Многие государства были полностью уничтожены, а население истреблено.
  • Уничтожение материальной и духовной культуры.
  • Грабеж империй майя, инков и ацтеков.
  • Были заложены основы работорговли и превращения туземцев в рабов.
  • Разрушены традиционные связи народов на островах, в Северной и Центральной Америке.

Доколумбовая Америка или что же увидел первооткрыватель, прибыв на материк

Америка, до момента ее открытия, была землей, где проживали определенные группы людей, которые веками пребывали в некой естественной изоляции. Все они волей судьбы оказались оторванными от всей остальной планеты. Однако несмотря на все это, смогли создать высокую культуру, продемонстрировав неограниченные возможности и мастерство.

Уникальности этих цивилизаций заключается в том, что они по своему характеру считаются природно-экологическими, а не техногенными, как наши. Местные аборигены, индейцы, не стремились преобразовывать окружающую среду, наоборот, их поселения максимально гармонично вписывались в природу.

Специалисты утверждают, что все цивилизации, возникшие в Северной Африке, Азии, Европе, развивались примерно одинаково. В доколумбовой же Америке это развитие проходило иным путем, поэтому, например, контраст между населением города и села был минимальный. Города древних индейцев также содержали обширные с/х угодья. Единственной существенной разницей между городом и деревней была площадь занимаемой территории.

В тоже время цивилизации доколумбовой Америки не особо продвинулась в том, на чем смогли подняться Европа и Азия. Например, индейцы не очень стремились совершенствовать технологи обработки металлов. Если в Старом Свете бронза считалась основным металлом и ради нее завоевывались новые земли, то в доколумбовой Америке этот материал использовался исключительно как украшение.

Зато цивилизации Нового Света интересны своими неповторимыми сооружениями, скульптурами и картинами, для которых был характерен абсолютно иной стиль.

Кто помнит о Колумбе?

В различных странах мира чтят память об адмирале и мореплавателе. В частности, в Южной Америке его именем названа страна – Колумбия. Есть одноименная провинция в Канале, река и округ в Соединенных Штатах. Столица островного государства Шри-Ланка называется Коломбо.

Природным объектам также присвоено имя Колумба, как и административных единиц. В частности, улицы, города, парки, скверы и мосты во многих государствах мира.

Памятник открывателю Индии стоит в Барселоне, который появился в городе в конце 1880-х гг.

О мореплаваниях Колумба сняты фильмы, сериалы, о нем рассказывают в документальных кинолентах. Кроме того, ученые постоянно изучают его жизнь и деятельность, находя в архивах новые документы о морских экспедициях, поступках в колониях, семье.

Смерть

После открытия Америки из последней экспедиции Колумб вернулся в Испанию смертельно больным, постаревшим человеком. В 1506 году первооткрыватель Нового Света скончался в бедности в маленьком домике в Вальядолиде. Сбережения Колумб потратил на оплату долгов участникам последней экспедиции.


Гробница Христофора Колумба

Вскоре после смерти Христофора Колумба из Америки стали приходить первые корабли, груженые золотом, о котором так мечтал мореплаватель. Многие историки сходятся во мнении, что Колумб знал, что открыл не Азию и не Индию, а новый, неизведанный континент, но не хотел ни с кем делиться славой и сокровищами, до которых оставался один шаг.

Внешность предприимчивого первооткрывателя Америки известна еще по фото в учебниках истории. О Колумбе снято несколько картин, последним вышел фильм совместного производства Франции, Англии, Испании и США «1492: Завоевание Рая». Памятники этому великому человеку установлены в Барселоне и Гранаде, а его прах из Севильи перевезен на Гаити.

Интересные факты биографии мореплавателя

  • До конца жизни считал, что доплыл к восточному берегу Азии. На самом же деле Колумб высадился в 15 тыс. км от него, выйдя к Индии.
  • Мореплаватель долгие семь лет уговаривал Фердинанда и Изабеллу, доказывая им, что океанская экспедиция принесет лавры Испании. Правители не верили незнакомому человеку, картографу и торговцу, который был незнаком испанскому обществу. Научные мужи того времени говорили о том, что поиск западного пути в Индию является авантюрой. Они просто не понимали, как можно плыть на запад, чтобы открыть новые земли. Находясь с 1485 г. в Испании, Колумб попал на прием к Фердинанду с Изабеллой только через 6 лет.
  • Первый экипаж для кораблей, которые должны были отправиться в путь в 1492 г., формировали из уголовников. Никто другой не хотел пускаться в незнакомое плавание с человеком, в чью идею не верили ученые и которому едва доверяли монархи.
  • Моряки во время первой экспедиции не знали точно, куда они плывут, какие расстояние им предстоит пройти. Экипаж воспринимал китов, альбатросов или водоросли в качестве признаков приближающейся земли. Колумб не говорил матросам, сколько корабли проходили за сутки. Люди долгое время не видели землю, поэтому с каждым днем их охватывала паника.
  • Колумб первым в мире увидел, что на компасе магнитная стрелка стала отклоняться от своего значения. В то время моряки и ученые верили в то, что магнитная стрелка должна показывать строго на Полярную звезду, а она все больше и больше отклонялась от нужного направления. Об этом наблюдении никто не знал, поскольку Колумб боялся, что это вызовет среди членов экипажа панику.
  • Жителей открытых земель и островов мореплаватель называл индейцами, название прижилось и используется сегодня.
  • Колумб в Европу привез новые виды продуктов, специи, лошадей и коров. Ни животные, ни продукты не были известны на континенте. Так в Испанию доставили картофель, помидоры, кукурузу и виноград. Европейцам довольно быстро оценили пользу животных и новых культур, что способствовало становлению нового торгового обмена между Европой и Америкой. Этот процесс стали называть Колумбов обмен.
  • Право называться родиной мореплавателя оспаривают 6 городов Италии и Испании.
  • На Багамских островах моряки и адмирал познакомился с новой культурой, которая пользовалась у туземцев популярностью. Новая трава, которую Колумб прихватил с собой в Испанию, называлась табак.
  • У Колумба были проблемы с монархами из-за того, что он не привез с плавания богатства, пряности, специи и драгоценные металлы. Вместо этого с берегов Кубы, Тортугу и Гаити были доставлены экзотические фрукты, растения, перья птиц и туземцы.
  • Путь в Индию был найден еще при жизни Колумба, когда в 1498 г. Васко да Гама достиг берегов этой страны.

Интересной является судьба останков Колумба, которые из Испании перевезли на Гаити. Когда испанцы ушли с острова, то прах великого мореплавателя перевезли в Гавану, п оттуда – в Санта-Доминго, а затем – Севилью. Долгое время считалось, что останки покоятся в кафедральном соборе, но генетические исследование доказали обратное. Было установлено, что кости принадлежат другом человеку в возрасте 45 лет. Колумбу же на момент смерти было около 60 лет. Где находятся сейчас останки мореплавателя, никто из историков не знает.

«Нина», «Пинта» и «Санта Мария»

Колумб отправился в путешествие от Канарских островов в сентябре 1492 года. Он управлял каравеллой (вид португальского корабля) «Санта Мария». Два других корабля, «Нина» и «Пинта», шли рядом с 90 моряками на борту. 12 октября 1492 года они достигли маленького острова в Карибском море, который Колумб назвал Сан Сальвадор. Этот день отмечается как день Колумба в США каждый второй понедельник октября; другие страны в Америке также отмечают этот день под разными именами.

Уверенный, что он прибыл в Ост-Индию, Колумб назвал коренных жителей индийцами. По его описанию добрым, но примитивным людям пришлось испытать на себе жестокое обращение со стороны европейцев.

Покидая Сан Сальвадор, команда продолжила путешествие вдоль побережья Кубы и Испаньолы (современных Гаити и Доминиканской республики). В предрождественский вечер «Санта Мария» разбилась о риф у острова Гаити. Сорок человек вынуждены были остаться в поспешно сконструированном лагере в поисках золота, пока Колумб, взяв «Нину» и «Пинту», плыл обратно в Испанию, чтобы объявить о своем успехе.

Несколько пленных коренных жителей были взяты на корабль в доказательство о достижении цели, однако некоторым из них не удалось выжить в тяжелом морском путешествии.

Колумб не был первым европейцем, ступившим на землю Нового Мира. Викинги обнаружили эту землю несколько столетий до этого. Но их набеги были разрозненными, и информация о них никогда не распространялась по Европе.

После открытия Колумба началась торговля товарами, людьми и идеями между двумя континентами.

НЕГАТИВНОЕ ВЛИЯНИЕ КОЛУМБИЙСКОГО ОБМЕНА

Хотя нельзя точно установить, сколько коренных американцев погибло из-за прибытия европейцев, но, по оценкам, 80-95 процентов умерли в течении 150 лет после прибытия Колумба. Наиболее пострадавшие регионы потеряли 100 процентов своего коренного населения. Хотя европейская жестокость была фактором, главной причиной этого были заболевания, завезенные в Новый Свет через Колумбийский обмен, такие как оспа, корь, малярия, тиф, ветряная оспа и желтая лихорадка. Кроме того, из-за обмена в Колумбии, разнообразие жизни на земле резко сократилось, а посадка сельскохозяйственных культур там, где они не должны были расти, нанесла ущерб окружающей среде. «Растения и животные, которые он привез с собой, привели к исчезновению большего количества видов жизненных форм за последние четыреста лет, чем обычные процессы эволюции могут погубить за миллион».

Мемориал крестов Св. Колумбы: послание надежды

В канун Нового года я посетил ежегодную Вечерю памяти крестов в церкви Св. Колумбы в Окленде. Ежегодно с 2004 года проводится церемония признания и памяти людей, убитых в Окленде в том году. В 2014 году было совершено 85 убийств по сравнению с 92 в 2013 году. На каждого убитого на лужайке перед церковью устанавливается белый крест с его именем.

Памятник крестам св.Церковь Колумбы в Окленде

Мы все собрались перед крестами – члены общины, семьи погибших, мэр Окленда Джин Куан, начальник полиции Шон Уэнт и религиозные лидеры. Когда Рич Лауфенберг, священник-добровольец церкви Св. Колумбы, назвал каждое имя покойного, их крест был вытянут и передан члену их семьи или кому-то из присутствующих. Когда было названо окончательное имя, мы вошли в церковь с пением «Как святые идут маршем» и возложили кресты на алтарь.

Это был мой первый раз, когда я был на Вечере, и это было отрезвляюще. Каждый крест представлял собой неисполненную судьбу, лишившую семью радости наблюдать за тем, как их любимый человек растет, взрослеет и испытывает чудеса жизни. Как родитель, я не могу представить потерю своего сына или дочери. Некоторые из моих самых теплых воспоминаний о моих детях — это читать им перед сном, подбадривать их на футбольных матчах или с гордостью смотреть, как они заканчивают среднюю школу и колледж. И теперь я получаю привилегию наблюдать, как они превращаются в прекрасных молодых людей.У этих семей в Окленде не будет такой радости или привилегии. Они никогда не увидят будущего, которое было бы у их любимого человека.

Три семьи поделились своим опытом утраты, также выступили мэр и начальник полиции Окленда. Отец Эйдан Макалинан из церкви св. Колумбы и отец Джейсон Ландеза из церкви св. Жанны д’Арк в Сан-Рамоне и бывший капеллан полицейского управления Окленда произнесли короткие, но убедительные слова. Католические благотворительные организации неоднократно упоминались о том, как мы были там на каждом шагу, помогая семьям с их горем.Сестры Мариан Кастеллуччо и Мишель Уоттс, два наших замечательных медицинских работника в области психического здоровья, были ангелами для скорбящих семей.

Надежда была темой мемориала. Мы надеемся, что эти жизни не будут потеряны напрасно, и сохраняем веру в то, что мы все можем внести свой вклад в прекращение насилия. Хотя это слово мы часто слышим в преддверии Нового года, оно обнадеживает, когда мы действительно видим, что надежда становится реальностью, которая меняет жизни людей. Так обстоит дело с сестрами Мариан и Мишель.Как прекрасно сформулировала Сестра: «Мы позволяем их боли коснуться нашего сердца и возлагаем на них надежду до тех пор, пока они не будут готовы сохранить ее для себя».

Консультирование по вопросам горя требует очень особого типа людей, таких как сестры Мариан и Мишель, которые каждый день питают надежду людей, пока они не будут готовы хранить ее для себя. К счастью, в нашем Департаменте психического здоровья таких ангелов больше: Розана, Иксаянн, Лео, Малли, Джордан, Кэт, Лаура, Асвад, Гимоне и Донна составляют нашу сеть кризисного реагирования.Это инструменты надежды, исцеляющие разбитые сердца людей.

С наилучшими пожеланиями до следующего раза,

Чак ​​

П.С. Я еще раз призываю вас узнать больше о том, как команда кризисного реагирования «исцеляет травму» и меняет жизни, предоставляя психологическую помощь, психологическую помощь и постоянную поддержку тем, кто страдает. Наши туры Transforming Lives Tours проходят во второй и третий четверг каждого месяца в нашем главном офисе, расположенном по адресу 433 Jefferson Street, Oakland.Пожалуйста, свяжитесь с Деброй Ганн по телефону 510-768-3142 или по электронной почте [email protected]

История святого Колумбы: современная битва за авторские права в Ирландии шестого века

У меня давно сложилось впечатление, что авторское право началось со Статута Анны в 1710 году, как это принято считать. Но слышали ли вы когда-нибудь о святом Колумбе (521–597)? Если нет, история будет звучать довольно знакомо по сравнению с современными битвами за авторские права. Но, к счастью, загрузка mp3 редко приводит к гибели 3000 человек.

ул.Колумба (иногда Columbkill, Columcille, Calum Cille или другие вариации) был ирландским гэльским миссионером и одним из Двенадцати апостолов Ирландии. Эти двенадцать были святыми, которые учились у святого Финиана в аббатстве Клонари.

Колумба был известен своей постоянной учебой и молитвой — очень, очень постоянной. Говорят, что он написал 300 книг, разумеется, от руки, продолжая переписывать их вплоть до ночи перед смертью.

Финиан и Колумба поссорились из-за псалтири. (Согласно одной из более длинных версий этой истории, это была Вульгата, латинский перевод Библии и первая ее копия, дошедшая до Ирландии, что делало ее довольно привлекательным произведением литературы.) Колумба позаимствовал рукопись у Финиана — возможно, без разрешения — и тайно скопировал ее с намерением сохранить для собственного использования. Но Финиан сказал нет, что это воровство — незаконное копирование! Он потребовал, чтобы Колумба отдал сделанную им копию.

Финиан обратился с этим вопросом к королю Диармайту мак Цербиалу, верховному королю Ирландии, для арбитража. Полагая, что он не сделал ничего плохого в своей попытке распространить слово церкви, Колумба согласился. (Ему не повредило то, что Диармайт был его родственником.)

Аргумент Финиана был прост: Моя книга. Вы не можете его скопировать. Он чувствовал, что если кто-то и собирается копировать его, то это должно быть сделано с помощью определенных процедур и уж точно не тайно под его собственной крышей.

Реакция Колумбы не сильно отличалась от тех, кто выступал за меньшие ограничения на цифровое копирование — что книга не пострадала от его копирования. «Неправильно, — сказал он, — чтобы божественные слова в этой книге исчезли или чтобы мне или кому-либо другому мешали написать их, прочитать или распространить среди племен.В своем заключительном слове он сказал суду, что те, кто владеет знаниями через книги, обязаны распространять знания, копируя и делясь ими. Он считал, что не делиться знаниями было гораздо большим преступлением, чем копировать книгу, которая ничего не потеряла. путем копирования

Но король вынес решение в пользу Финиана, сказав: «Каждой корове принадлежит ее теленок, каждой книге — ее копия». Другими словами, каждая копия книги принадлежала владельцу оригинальной книги.

Конечно, на этом история не закончилась.После дальнейших споров и следующего преступления Колумбы (укрывательство беглеца из Диармайта) результатом стала битва при Кул Дреймне, смерть 3000 человек и изгнание Колумбы.

Рэй Корриган написал очень интересную версию истории (PDF) в статье для Gikii в 2007 году, если вы хотите прочитать больше.

90 000 Акции с высокой оценкой, благотворительные пролонгации IRA и подарки, рекомендованные донорами

Инструкции по подарочным акциям:

Wells Fargo Advisors
Главный телефон: 301-961-0100 (пн-пт 8:30–17:00)

Jennifer C.PCASCAL
PCG старший зарегистрированный клиент ассоциирован
ассистент вице-президент
[электронная почта защищена]

Deborah E. Bowles, CFP ®
Управляющий директор — инвестиции
Accredited Accredited внутреннее партнерство советник см
[электронная почта защищена]

DTC 0141
Acct 7988-0030
FBO Епископальная церковь Св. Колумбы

Идентификационный номер налогоплательщика/ИНН: 53-0232824

Пожалуйста, укажите, предназначен ли подарок для Епископальной церкви Св. Колумбы, и укажите имя жертвователя.Напишите Бронвин Рою, чтобы сообщить нам, что подарок готовится. Мы предупреждаем, что налоговая ситуация каждого человека уникальна, и перед тем, как дарить ценные ценные бумаги, следует проконсультироваться с вашим налоговым консультантом.

Инструкции по подключению:

Если вы хотите подключить свой подарок, пожалуйста, свяжитесь с Bronwyn Roy для получения инструкций по подключению.


Часто задаваемые вопросы об альтернативных транспортных средствах:

Акции с высокой стоимостью

Подарок ценных акций, которыми вы владели более года, может быть эффективным с точки зрения налогообложения способом сделать подарок в честь Св. Колумба. Допустим, вы заплатили 500 долларов за 10 акций корпорации XYZ более года назад, и теперь они стоят 1000 долларов. Вы можете подарить эту 1000 долларов XYZ Corp. фонду St. Columba’s и получить благотворительный вычет за справедливую рыночную стоимость акций в день их передачи. Вы также избежите уплаты налога на прирост капитала при увеличении стоимости с течением времени, который вам пришлось бы заплатить, если бы вы продали акции, а затем отдали деньги на благотворительность. А St. Columba’s может продавать акции без уплаты налогов. Короче говоря, делая подарок ценными ценными бумагами, вы получаете те же налоговые льготы, что и при оплате наличными, плюс вы избегаете потенциальных налогов на прирост капитала.

Благотворительный перенос IRA
Для прихожан в возрасте 70 1/2 лет и старше благотворительный перенос IRA является еще одним способом пожертвования. Благотворительный перенос IRA позволяет физическим лицам делать определенные благотворительные взносы непосредственно с вашего индивидуального пенсионного счета. Переданные активы не будут признаваться доходом для целей налогообложения. Сделать пожертвование в соответствии с этим положением просто и понятно. Если вы хотите сделать вклад в St. Columba’s от вашего IRA, поговорите со своим администратором IRA.

Подарки, рекомендованные донорами
Фонд, рекомендованный донорами, немного похож на личный благотворительный сберегательный счет. Даритель создает учетную запись и вносит наличные деньги, акции или другие активы, такие как недвижимость или произведения искусства, и может получить немедленный налоговый вычет за подарок.

Подарки, рекомендованные донором, могут быть сделаны для выполнения обещания, но мы рекомендуем использовать следующую формулировку для сопровождения вашего обещания:

ОБРАЗЕЦ ЯЗЫКА ДЛЯ НЕОБЯЗАТЕЛЬНОГО ПИСЬМА О НАМЕРЕНИЯХ

Я/Мы намерены рекомендовать грант от [название фонда, рекомендованного донорами], фонда, рекомендованного донорами, в размере _________ долларов США [в течение 20__ года /ежегодно в течение 20__-20__ годов]. Рекомендации по грантам подлежат утверждению [название общественной благотворительной организации, спонсирующей фонд, рекомендованный донорами]. Это выражение намерения не создает юридически закрепленного обязательства.

Мы настоятельно рекомендуем проконсультироваться с вашим финансовым консультантом, если вы планируете сделать подарок, рекомендованный донором, чтобы выполнить свое обещание.

Подарки на конец года
Мы очень благодарны за все подарки, подаренные Святому Колумбе. Подарки, подаренные в конце года, требуют особого внимания к деталям.Чтобы вы могли претендовать на вычет из налоговой декларации за 2020 год, все, что отправляется по почте в St. Columba’s, должно быть проштемпелевано до полуночи 31 декабря 2020 года. начало января. Подарки по кредитным картам также должны быть отправлены на наш счет поставщика до полуночи 31 декабря. Если вы решите подарить акции или другие ценные бумаги St. Columba’s, важно инициировать эти транзакции до середины декабря, чтобы убедиться, что они размещены на нашем брокерском счете в конце рабочего дня 1 декабря. 31.

Вопросы?
Свяжитесь с Bronwyn Roy (202) 363-4119 x 229, чтобы обсудить способы сделать подарок St. Columba’s.

X Факты о Колумбе (тип, расстояние, цвет, местоположение и т. д.)

X Факты о Колумбе

  • X Колумба — звезда.
  • X Колумба не является частью контура созвездия Колумба, но находится в пределах границ созвездия.
  • Основываясь на спектральном классе (M8 D) звезды, цвет X Columbae красный.
  • X Расстояние Колумба от Земли составляет 7233,61 световых года.

X Columbae Location

Положение звезды на ночном небе определяется прямым восхождением (R.A.) и склонением (Dec.), они эквивалентны долготе и широте на Земле. Прямое восхождение — это то, как далеко во времени (чч:мм:сс) звезда находится вдоль небесного экватора. Если Р.А. положительно, то на восток. Склонение — это то, насколько далеко на север или юг объект находится по сравнению с небесным экватором, и выражается в градусах. Для X Columbae расположение 05 26 12.5743968451 и -28 50 20.593769810 .

X Радиальная скорость Колумба и собственное движение

X Собственное движение Колумба

Все звезды, как и планеты, вращаются вокруг центральной точки, в случае планет это центральная звезда, такая как Солнце. В случае со звездой это галактический центр. Созвездия, которые мы видим сегодня, будут отличаться от тех, что были 50 000 лет назад или через 50 000 лет. Собственное движение детализирует движения этих звезд и измеряется в миллисекундах дуги.Звезда движется со скоростью 8,89 миллисекунд дуги/год на север и 4,84 миллисекунд дуги/год на восток, если мы видели их на горизонте.

X Columbae Radial Velocity

Радиальная скорость, то есть скорость, с которой звезда удаляется/по направлению к Солнцу, составляет 48,00000 км/с. Когда значение отрицательное, звезда и Солнце сближаются, и положительное число означает, что две звезды удаляются. Нечего бояться, поскольку звезды так далеко друг от друга, что при нашей жизни они не столкнутся, если вообще когда-либо.

X Columbae Физические свойства

X Columbae Цвет

Основываясь на спектральном классе звезды M8 D, цвет и тип X Columbae — красная звезда. Основываясь на спектральном классе, мы можем сделать вывод, что температура поверхности звезды составляет порядка 3500 К на основе заметок Гарвардского университета. Для сравнения: по данным Google, температура нашего Солнца составляет около 5778 Кельвинов.

X Расстояние Колумба от Земли

Параллакс звезды равен 0.45090, что дает расчетное расстояние до X Columbae, равное 7233,61 светового года от Земли или 2217,79 парсека. Это около 42 523 683 285 714 693 миль от Земли.

Размер звезды примерно 457 448 837,10 астрономических единиц от Земли/Солнца плюс-минус несколько. Астрономическая единица — это расстояние между Землей и Солнцем. Количество А.У. это число раз, которое звезда находится от Земли по сравнению с Солнцем.

X Время в пути Колумба

Время, которое потребуется, чтобы добраться до этой звезды, зависит от того, насколько быстро вы движетесь. У.Г. сделал некоторые расчеты относительно того, сколько времени это займет на разных скоростях. Примечание о расчетах: когда я говорю о годах, я говорю только о невисокосных годах (365 дней).

Космический зонд «Новые горизонты» — самый быстрый зонд, который мы отправили в космос на момент написания статьи. Его основной миссией было посетить Плутон, который на момент запуска (2006 г.) Плутон все еще был планетой.

1 Мах — это скорость звука, 2 Мах — это удвоенная скорость звука. До выхода на пенсию Corncorde была самой быстрой коммерческой авиакомпанией через Атлантику и единственной, которая могла развивать скорость 2 Маха.

Описание Скорость (миль / ч) Время работы (лет)
Walking 4 1,212,744,788,425.17
Автомобиль 120 40,424,826,280.84
Airbus A380 736 6 591,004 284.92
MACH 1 MACH 1 767. 269 7674 6,3222396 908,65
Мах 2 1,534.54 3,161,194,334.26
New Horizons 33.000 146,999,368.29
Скорость света 670,616,629.00 7,233.61

Тип переменной

Звезда представляет собой тип переменной Omicron Ceti, что означает, что его размер меняется со временем. Тип переменной обычно называют в честь первой обнаруженной звезды этого типа.

Сравнение между X Columbae и Солнцем

Ниже приведена таблица фактов о звездах со значениями Солнца справа, чтобы вы могли сравнить с нашей собственной звездой, Солнцем.Солнце — ближайшая к нам звезда, оно согревает нас и дает нам свет, когда мы совершаем один оборот за 365,24 дня.

Если вы хотите увидеть сравнение между X Columbae и нашей звездой, Солнцем, вам понадобится экран размером не менее 800 пикселей в поперечнике. Поворота экрана может быть достаточно, чтобы увидеть значения Stellar для сравнения.

Визуальные факты


4 Прямое восхождение (Прямое восхождение)А. миллисекунд дуги)
x
X Columbae Sun
M8 D G2V
Тип звезды на основе спектрального типа Звезда Главная последовательность звезды
цвет Red желтый (атмосфера) / белый (в космосе)
Galaxy Млечный путь Млечный путь
Созвездие Колумба Н/Д
Главная звезда созвездия Н/Д
Н/Д
  7233,61 световых лет 8 лит. мин, 20 лит. сек.
  2217,79 парсеков 0,000004848 парсеков
  457 448 837. 10 Астрономические единицы 1
Собственное движение Дек. 8,88700 миллисекунд дуги/год 4,84300 / год угловых миллисекунд N / A
Radial Velocity 48,00000 км / с
RedShift 0,0001600000

Компаньоны (Multi- Звезды и экзопланеты) Факты


Количество экзопланет Нет/не знаю 8 (9 вкл.Pluto)

Изменная звезда Детали


Источники и ссылки


Источник http://simbad.u-strasbg.fr/simbad/sim-id?ident=x columbae
Факты Источник

5 ярчайших звезд Колумбы

Генетика и эволюция цвета глаз у домашних голубей (Columba livia)

Аннотация

пигменты и структурная окраска.Цвета радужной оболочки птиц демонстрируют поразительные межвидовые, а у некоторых домашних видов и внутривидовые вариации, что свидетельствует об уникальной эволюционной и экологической истории. Здесь мы рассмотрели генетическую основу жемчужного (белого) цвета радужной оболочки у домашних голубей ( Columba livia ), чтобы выяснить малоизвестный генетический механизм, лежащий в основе эволюции окраски радужной оболочки птиц. Используя полногеномное ассоциативное исследование (GWAS) у 92 голубей, мы сопоставили признак жемчужной радужки с областью 9 т.п.н. и геном облегчающего переносчика глюкозы SLC2A11B .Бессмысленная мутация W49X, приводящая к преждевременному стоп-кодону в SLC2A11B, была идентифицирована как причинный вариант. Анализ транскриптома показал, что потеря функции SLC2A11B может подавлять ген дифференцировки ксантофоров CSF1R и ключевой ген GCh2 , участвующий в биосинтезе птеридина, отсутствие которого приводит к жемчужной радужке. Коалесценция и филогенетический анализ показали, что мутация возникла около 5400 лет назад и совпала с началом одомашнивания голубей, в то время как был обнаружен положительный отбор, вероятно, связанный с искусственным разведением. В Aves потенциально нарушенный SLC2A11B был обнаружен у 10 видов из шести различных линий, коррелирующих с их характерными карими или голубыми глазами. Анализ ортологов SLC2A11B позвоночных выявил ослабленный отбор в птичьей кладе, что согласуется со сценарием, согласно которому во время и после дивергенции птиц от предка-рептилии SLC2A11B-связанное развитие кожных хроматофоров, вероятно, дегенерировало из-за покрытия перьями. Наши результаты дают новое представление о механизме изменения цвета радужной оболочки птиц и эволюции пигментации у позвоночных.

Заявление о конкурирующих интересах

Авторы заявили об отсутствии конкурирующих интересов.

Молекулярное клонирование и характеристика гена HSP60 у домашних голубей (Columba livia) и паттерны дифференциальной экспрессии при температурном стрессе

Шапероны клеточного стресса. 2021 янв; 26(1): 115–127.

, 1, , 1, 2 , 1, 3 , 1, 4 , 1, 4 , 1, 2 и 1 1

Jianke Yang

1

1 Школа доклинической медицины, Wannan Medical College, Wuhu, 241001 China

2 Научно-исследовательская лаборатория Micro Zuremonment, Wannan Medical College, Wuhu, 241001 China

Хуан Гу

1 Школа доклинической медицины , Wannan Medical College, Wuhu, 241001 China

3 Фармацевтическая школа, Wannan Medical College, Wuhu, 241001 China

Yuqing Hu

1 School of Preclinical Medicine, Wannan Medical College 20 900 3, Wu0hu4, Wu0hu 4 Школа клинической медицины, Медицинский колледж Ваннань, Уху, 241001 Китай

Нань Ван

1 Школа доклинической медицины, Медицинский колледж Ваннань, Уху, 241001 Китай

4 Школа клинической медицины, Wannan Medical College, Wuhu, 241001 China

Jiguang Gao

1 Школа доклинической медицины, Wannan Medical College, Wuhu, 241001 China

2 Научно-исследовательская лаборатория Микросреда опухоли, Медицинский колледж Ваннань, Уху, 241001 Китай

Пинг Ванг

1 Школа доклинической медицины, Медицинский колледж Ваннань, Уху, 241001 Китай

1

1 Школа доклинической медицины Вуннань, 4 1 Школа доклинической медицины Вуанна Китай

2 Исследовательская лаборатория опухолевой микросреды, Медицинский колледж Ваннань, Уху, 241001 Китай

3 Фармацевтическая школа, Медицинский колледж Ваньнань, Уху, 241001 Китай

Медицинский колледж Ваннал, Медицинский колледж Вуху, 4 , Уху, 241001 Китай

Автор, ответственный за переписку.

Поступила в редакцию 20 апреля 2020 г .; Пересмотрено 19 августа 2020 г .; Принято 25 августа 2020 г.

Copyright © Cell Stress Society International 2020Эта статья была процитирована другими статьями в PMC.

Abstract

Белок теплового шока 60 (HSP60) является хорошо известным многофункциональным белком, играющим существенную роль в защите организмов от стресса окружающей среды. Домашний голубь ( Columba livia ) является многообещающим модельным организмом, имеющим важное экономическое и экологическое значение, и его здоровье подвержено температурному стрессу.Чтобы изучить молекулярные характеристики, профиль экспрессии в тканях и реакцию на температурный стресс для HSP60 Columba livia ( Cl HSP60), мы сначала клонировали и охарактеризовали полную последовательность кДНК и исследовали профиль ее экспрессии в оптимальных условиях и при остром температурном стрессе. . кДНК Cl HSP60 содержала 2257 нуклеотидов, состоящих из 12 экзонов длиной от 65 до 590 п. н. Открытая рамка считывания (ORF) кодировала 573 аминокислоты с расчетной молекулярной массой 60.97 кДа, которые содержали ряд структурно заметных доменов или мотивов. В оптимальных температурных условиях уровни экспрессии Cl HSP60 различались между всеми тестируемыми тканями (наивысший отмечен в печени, а наименьший — в большой грудной мышце). При остром температурном стрессе в тестируемых тканях было обнаружено пять моделей изменений, что позволяет предположить, что разные ткани домашних голубей по-разному реагировали на различные условия температурного стресса. Повышение экспрессии Cl HSP60 было самым высоким в легких и большой грудной мышце, что отражает решающую роль этих двух тканей в регуляции температуры.Однако зоб, головной мозг и сердце показали небольшие изменения или снижение экспрессии Cl HSP60. Результаты показывают, что Cl HSP60 может быть чувствительным к острому температурному стрессу и играть ключевую роль в реагировании на него.

Электронный дополнительный материал

Электронная версия этой статьи (10.1007/s12192-020-01160-7) содержит дополнительные материалы, доступные авторизованным пользователям.

Ключевые слова: HSP60, Домашний голубь, Дифференциальная экспрессия, Температурный стресс

Введение

Белки теплового шока (HSP), также известные как стрессовые белки или белки-шапероны, представляют собой группу высококонсервативных белков от прокариот до эукариот, которые играют решающую роль в белковом гомеостазе, передаче сигналов и иммунном ответе (Feder and Hofmann, 1999; Lindquist, 1986).Их также можно индуцировать и быстро синтезировать для защиты организмов от повреждений, вызванных экологическим стрессом, таким как жара, холод, соленость, тяжелые металлы, пестициды и кислородные радикалы (Федер и Хофманн, 1999; Соренсен и др., 2003; Чжу и др., 2013). ). На основании сохранения их последовательностей и молекулярной массы их можно разделить на шесть семейств: HSP110, HSP90, HSP70, HSP60, HSP40 и малые HSP (Kampinga et al. 2009). Среди них HSP60, также обозначаемый как GroEL/Cpn60/HSPD1, является важным членом суперсемейства HSP, который состоит из 14 субъединиц, образует двухслойную кольцевую структуру и способствует сворачиванию белков в центральных полостях.Гидрофобные остатки, выровненные по внутреннему краю центральных полостей, необходимы для рефолдинга белка и гидролиза АТФ (Fang and Cheng 2002). Каждая субъединица HSP60 представлена ​​тремя структурно заметными доменами: апикальным, промежуточным и экваториальным доменами. Апикальный домен взаимодействует с HSP10, экваториальный домен обеспечивает сайты связывания ATP-Mg 2+ , а промежуточный домен действует как мостик, соединяющий апикальный домен и экваториальный домен (Bukau and Horwich 1998; Motojima 2015).На митохондриальной поверхности HSP60 повторно сворачивает импортированные белки и восстанавливает неправильно свернутые или развернутые белки, связанные с его ко-шапероном HSP10, требующие множественных событий гидролиза АТФ. В цитозоле HSP60 взаимодействует с p53, Bax и каспазой-3, предотвращая апоптоз клеток и повышая толерантность к стрессу. Однако массивное накопление HSP60 может ускорить активацию каспазы-3 и вызвать высвобождение цитохрома с, способствуя клеточному апоптозу (Wu et al. 2017). Во внеклеточном пространстве HSP60 может активировать макрофаги и дендритные клетки для высвобождения воспалительных цитокинов и регулировать функцию Т-клеток и В-клеток посредством связывания с рецепторами клеточной поверхности, такими как толл-подобный рецептор 2 (TLR2), TLR4 и CD14 (Heiserman). и другие.2015). Кроме того, HSP60 способствует прогрессированию и развитию опухоли путем взаимодействия с α3β1-интегрином (Cappello et al. 2008). Примечательно, что HSP60 участвует в чрезвычайно важных клеточных процессах при нормальном функционировании клеток, а нарушение экспрессии HSP60 связано с различными заболеваниями, такими как шаперонопатии, аутоиммунные заболевания, рак, атеросклероз, болезнь Альцгеймера, сердечная недостаточность и др. (Chatterjee and Бернс, 2017; Грундтман и др., 2011).

Предыдущие исследования показали, что температурный стресс, в том числе горячий и холодный стресс, может привести к снижению фертильности, замедлению роста, низкой яйценоскости и даже гибели, особенно у птиц, которые более чувствительны к температурному стрессу из-за быстрого метаболизма, высокая температура тела и отсутствие потовых желез (Al-Zghoul et al. 2015 г.; Купер и Уошберн, 1998 г.; Федер и Хофманн, 1999 г.; Хансен 2009; Йошимото и др. 2017). Несколько семейств HSP участвуют в реакции теплового шока, регулируемой активностью факторов транскрипции (Feder and Hofmann, 1999; Xie et al., 2014), и индуцируются, чтобы помочь клетке противостоять вредному воздействию температурного стресса (Al-Zghoul et al. и др., 2015 г.; Мартинес-Пас и др., 2014 г.; Чжао и др., 2014 г.). Температурный стресс также может вызывать увеличение количества активных форм кислорода (АФК) и, таким образом, индуцировать окислительный стресс (Ding et al.2018; Чжао и др. 2014), что в дальнейшем может привести к накоплению развернутых белков в митохондриях и последующему ответу митохондриальных развернутых белков (UPR mt ) (Shpilka and Haynes 2018). HSP60 в качестве эффекторной молекулы UPR mt является энергозависимым белком, который использует АТФ-связывание и гидролиз для поддержки рефолдинга поврежденных белков при стрессе (Dahl et al. 2015; Zhao et al. 2002). Это может быть одним из механизмов, лежащих в основе реакции HSP60 на температурный стресс.Более того, экспрессия HSP60 также может быть вызвана другими стрессовыми условиями окружающей среды, такими как pH (Shi et al. 2016), ионы металлов, лекарства (Li et al. 2014) и патологические стимулы (Chatterjee and Burns 2017). На сегодняшний день ген HSP60 был секвенирован на различных животных моделях, особенно в модельных организмах млекопитающих (Deng et al. 2018; Shi et al. 2016; Zhou et al. 2018). Однако он почти не исследовался у птиц, за исключением кур ( Gallus gallus domesticus ) (Al-Zghoul et al.2015 г.; Чжу и др. 2013) и утку Шань Ма ( Anas platyrhynchos ) (Wang et al. 2012).

Домашний голубь ( Columba livia domestica ) — подвид голубя, который произошел от сизого голубя (также называемого сизым голубем) и является одним из более чем 300 видов птичьего семейства Columbidae (Kan et al. 2010; Шапиро и Домьян, 2013). Голуби вырастают в гнезде до очень больших размеров, прежде чем оперятся и смогут летать, и на этой стадии своего развития (когда их называют голубями) они ценятся в качестве пищи (Ye et al. 2016). Взрослых домашних голубей также используют в качестве домашних животных, а также в гонках, шоу, спорте или для передачи сообщений (Шапиро и Домьян, 2013). Кроме того, ряд особенностей, таких как их простая генетическая архитектура, диверсифицированная морфология и поведение, а также аннотированный эталонный геном, делают голубей многообещающими модельными организмами для эволюционной генетики и биологических наук (Шапиро и Домьян, 2013; Джонс и др., 2019; Домьян и Шапиро, 2017). ; Холт и др., 2018; Ли и др., 2014). Домашние голуби являются теплокровными животными без потовых желез и обладают высокой способностью к терморегуляции за счет поведенческой и физиологической гибкости, что имеет большое значение для поддержания их роста и размножения (Al-Zghoul et al.2015 г.; Анжелье и др. 2016; Барнас и Раутенберг, 1984; Граф 1980). Хотя температурная регуляция голубей достаточно хорошо изучена (Ариели и др., 2002; Барнас и Раутенберг, 1984; Хеллер и др., 1983; Некер и Раутенберг, 1975; Пелтонен и др. , 2000), молекулярный механизм, с помощью которого домашние голуби реагируют на температурный стресс во многом неизвестен. Это исследование посвящено дифференциальной экспрессии гена HSP60 ( Cl HSP60) у домашних голубей в нормальных условиях и при температурном стрессе.Кроме того, хотя весь геном домашних голубей был собран и аннотирован (Shapiro et al. 2013), существует последовательность Cl HSP60 с частично отсутствующими данными и грубыми аннотациями, что создает основную проблему при проведении углубленных исследований ее эволюции. и регулирование.

Целью настоящего исследования было сначала клонировать и охарактеризовать полную последовательность кДНК гена HSP60 домашних голубей ( Cl HSP60), а затем изучить профиль его экспрессии в различных тканях как в оптимальных условиях, так и в условиях теплового стресса.Во-первых, мы использовали частичную последовательность ДНК, доступную для Cl HSP60, чтобы охарактеризовать последовательность гена полной длины и провести структурный анализ. Во-вторых, мы охарактеризовали полную последовательность кДНК и провели филогенетический анализ. Наконец, мы исследовали уровни экспрессии Cl HSP60 в различных тканях как в условиях оптимального, так и температурного стресса с помощью количественной ПЦР, иммуногистохимии (ИГХ) и вестерн-блоттинга. Наши результаты способствуют нашему пониманию структуры, филогении и экспрессии HSP60 у домашних голубей и дают новое представление о механизме реакции домашних голубей на температурный стресс.

Материалы и методы

Животные и методы лечения

В настоящем документе 70 здоровых взрослых домашних голубей (в возрасте > 2 лет) были собраны с коммерческой фермы в Уху (Аньхой, Китай) и содержались в клетке в течение 1 недели в качестве акклиматизации. период при стандартной диете и доступе к достаточному количеству воды. Клетка поддерживалась при 25 ± 1°C при цикле свет-темнота 12 ч/12 ч. После периода акклиматизации голубей случайным образом распределяли по одному из трех температурных режимов: (1) 5 °C (холодовой стресс), (2) 38 °C (тепловой стресс) и (3) 25 °C (оптимальная температура, контрольная температура). группа).Голубей в каждой экспериментальной группе помещали отдельно в камеру с искусственным климатом с постепенно снижающейся/повышенной температурой в один и тот же момент времени, а затем делили на четыре подгруппы, каждую из которых выдерживали в течение 2, 4, 6 или 8 часов при каждой температуре (либо 5 , 25 или 38 °C) в камере с искусственным климатом при свободной деятельности и доступе к достаточному количеству воды (т. е. всего 12 групп обработки, состоящих из четырех временных точек при каждой из трех температур, n  = 6 на группу обработки ).По истечении соответствующего периода времени при каждой температурной обработке ткани девяти различных органов, включая почки, зоб, сердце, желудок, печень, мозг, мышцы, кишечник и легкие, собирали и немедленно замораживали в жидком азоте, а затем хранили при − 80 °C до дальнейшего использования. Эксперимент проводился в соответствии с Руководством по уходу и использованию лабораторных животных, а протокол исследования был одобрен Комитетом по этике животных Ваньнаньского медицинского колледжа (Китай). Затем экстрагировали РНК и белок и использовали для анализа тканевой дифференциальной экспрессии Cl HSP60.РНК из ткани кишечника также использовали для клонирования полной кДНК Cl HSP60. Кроме того, образец крови из контрольной группы хранился при температуре - 20 °C для выделения ДНК с целью амплификации частичной последовательности ДНК Cl гена HSP60, а другие вышеупомянутые девять различных образцов органов из контрольной группы были зафиксированы в 4% параформальдегида при комнатной температуре для анализа ИГХ.

Экстракция ДНК и амплификация в полимеразной цепной реакции

Для получения частичной последовательности ДНК Cl гена HSP60, отсутствующего в аннотированном геноме голубей, геномную ДНК выделяли из образцов крови контрольной группы с использованием набора TIANamp Genomic DNA Kit (TIANGEN). , Пекин, Китай) в соответствии с инструкцией производителя и хранили при температуре - 20 °C.Фрагмент ДНК амплифицировали с использованием пары специфических праймеров: CHSP60F и CHSP60R (таблица), которые были сконструированы на основе последовательностей геномной ДНК близкородственного вида Streptopelia turtur («type»:»entrez-нуклеотид»,» attrs»:{«text»:»LR594557. 1″,»term_id»:»1676320218″,»term_text»:»LR594557.1″}}LR594557.1) с помощью программного обеспечения Primer 5.0. ПЦР-амплификацию проводили следующим образом: начальную денатурацию при 95°С в течение 3 мин, затем 30 циклов денатурации при 94°С в течение 30 с, отжиг при 55°С в течение 30 с и удлинение при 72°С в течение 1 мин, и окончательное удлинение при 72 °С в течение 10 мин.Амплифицированные продукты содержали несколько полос, причем полоса ожидаемого размера фрагмента была выбрана и очищена с использованием набора для очистки TIANgel (TIANGEN, Пекин, Китай). Затем очищенные продукты клонировали в векторы ТА с использованием набора векторов для клонирования pUCM-T (BioBasic, Торонто, Канада). Три ожидаемых клона секвенировали непосредственно с соответствующими универсальными праймерами на секвенаторе ABI-PRISM 3730 (Applied Biosystems, Фостер-Сити, Калифорния, США). Окончательные последовательности были идентифицированы с помощью BLAST, выполняющего поиск в базе данных GenBank (https://blast. ncbi.nlm.nih.gov/) и выравнивание с гомологичными последовательностями близкородственных видов.

Таблица 1

Праймеры, использованные в данном исследовании

Применение DNA Cloning CHSP60R GSP1 F0 GSP2 R 0 gapdhF2 90 689 ATCCATGACAACTTCGGCATCGT
Праймер последовательности (5′-3 ‘)
CHSP60F GTGTTAGAGAGGTGCTGTGTG
GGTTCAGGAGATAAAGCAAGT ДНК клонирования
CTGAACTGAAGAAGCTGTCGAAACC Частичное клонирование кДНК
TCACTCGGTCTTTCTTCTCGTTCAC Частичное клонирование кДНК
GSP1F3 AGTGTACAGTCCATAGTTCCAGC 3′-RACE, КПЦР
GSP1F4 TGAACGAGAAGAAAGACCGAGTG 3′-RACE
GSP2R3 GTAGCAATGGCCATGTCCTTAAG 5′-RACE, КПЦР
GSP2R6 TCCCGCCTCCTCATTTGTGTTGT 5′-RACE
КПЦР
gapdhR2 ATGACTTTTCCCACAGCCTTAGCAG КПЦР

экстракции РНК и обратной транскрипции

Суммарную РНК экстрагировали из рассеченных тканей с использованием реагента TRIzol (Invitrogen, Carlsbad, CA, USA) в соответствии с протокол производителя, а концентрацию и качество определяли с помощью спектрофотометра DS-11 (DeNovix, Wilmington, DE, USA) и электрофореза в агарозном геле. Отношение поглощения при 260/280 нм использовали в качестве показателя чистоты образцов РНК с ожидаемым значением от 1,8 до 2,0, а нестандартную РНК (значение отношения > 2,0 или < 1,8) повторно экстрагировали. Затем РНК обрабатывали ДНКазой I, не содержащей РНКазы (Thermo Fisher Scientific, Уолтем, Массачусетс, США), для удаления остаточной ДНК перед хранением при температуре - 80 °C. Для обратной транскрипции использовали олиго(dT) праймеры и обратную транскриптазу MMLV (Promega, Мэдисон, Висконсин, США) для синтеза кДНК в соответствии с инструкциями производителя, и перед дальнейшим анализом продукт хранили при температуре - 20 °C.

Клонирование ClHSP60 и анализ последовательности

РНК, выделенную из ткани кишечника, использовали в качестве матрицы для полной амплификации Cl HSP60 с помощью технологии быстрой амплификации концов кДНК (RACE), и шесть праймеров (таблица) были разработаны на основе частичного предсказанного последовательность мРНК (XM021289796). Как 5′-, так и 3′-RACE выполняли с помощью вложенной ПЦР-амплификации с использованием набора 5′-RACE и набора 3′-RACE (TIANDZ, Пекин, Китай) по отдельности в соответствии с инструкциями производителя.Продукты ПЦР очищали, клонировали и секвенировали, как описано выше. Все реакции проводили в трехкратной повторности. Полученные последовательности собирали и проверяли с помощью программ Sequencer 4.14 (Gene Codes Corporation, Мичиган, США) и BioEdit 7.2.1 (Hall 1999). Затем полный Cl HSP60 был подвергнут анализу в базе данных полного генома домашнего голубя с помощью местной программы BLAST для определения конкретного расположения экзонов и интронов с пороговым значением e-5 1e-5. Открытая рамка считывания (ORF) была предсказана с помощью ORFfinder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), сигнальные пептиды идентифицировали с помощью SignalP (http://www.cbs.dtu.dk/Services/SignalP/) и изоэлектрической точки (pI), теоретической молекулярную массу и аминокислотный состав, а также индексы периода полураспада и нестабильности рассчитывали с помощью ProtParam (http://web. expasy.org/protparam/). NetPhos 3.1 (Blom et al. 2004) с оценкой  > 0,95 использовали для предсказания сайтов фосфорилирования, а GC- и AT-перекосы использовали для измерения асимметричного нуклеотидного состава (Frank and Lobry 1999).Домены и некоторые важные функциональные сайты также были предсказаны с помощью SMART (http://smart.embl-heidelberg.de/), а SOPMA (Geourjon and Deleage 1995) использовалась для предсказания вторичной структуры. Более того, относительное использование синонимичных кодонов (RSCU) и индекс адаптации кодонов (CAI) также были рассчитаны с использованием сервера CAIcal (Puigbò et al. 2008) для изучения характеристик синонимичных кодонов. Наконец, третичная структура белка была предсказана с помощью SWISS-MODEL (https://swissmodel.expasy.org/interactive/) и визуализирована с помощью PyMOL 2.3 (ДеЛано 2002).

Выравнивание последовательностей и филогенетический анализ

Репрезентативные последовательности мРНК HSP60 были загружены из NCBI (https://www. ncbi.nlm.nih.gov/), и выравнивание нескольких последовательностей было выполнено с использованием MAFFT 7.2 (Katoh и Стэндли 2013). Парные генетические расстояния и идентичность последовательностей оценивали с помощью программного обеспечения MEGA X-10.1 (Kumar et al. 2018) и BioEdit 7.2.1 (Hall 1999) соответственно. Для дальнейшего изучения эволюционных взаимоотношений HSP60 у животных мы построили филогенетические деревья, используя метод максимального правдоподобия (ML) в RaxML GUI 2.0 (Сильвестро и Михалак, 2012), а также метод соседнего соединения (NJ) с 1000 бутстрэп-реплицированием с использованием MEGA X-10.1. Две бактерии ( Nocardia farcinica и Bifidobacterium inopinatum ) были выбраны в качестве внешних групп. Насыщенность замен была рассчитана с помощью DAMBE 7.0 (Xia 2018), и результаты показали, что все три положения кодона были ненасыщенными. После этого наиболее подходящая модель была оценена с помощью jModelTest 2.1.6 (Darriba et al. 2012), а GTR + I + G был выбран информационным критерием Акаике (AIC). Наконец, филогенетическое дерево было визуализировано и аннотировано с помощью программы Evolview 3.0 (Subramanian et al. 2019).

Количественная ПЦР и экспрессия гена ClHSP60

Для изучения уровней мРНК Cl гена HSP60 в различных тканях домашних голубей в условиях оптимального и острого температурного стресса в качестве матрицы была выбрана кДНК каждой ткани, глицеральдегид-3-фосфатдегидрогеназа (GAPDH) использовали в качестве внутреннего контроля (Al-Zghoul et al. 2015; Livak and Schmittgen 2001), а количественную ПЦР проводили с использованием PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, Уолтем, Массачусетс, США) на StepOnePlus™ Система ПЦР в реальном времени (Applied Biosystems, Фостер-Сити, Калифорния, США).Все праймеры перечислены в таблице. Условия амплификации были следующими: начальная денатурация при 95°С в течение 10 мин, затем 40 циклов денатурации при 95°С в течение 15 с, отжиг при 60°С в течение 30 с и удлинение при 72°С в течение 30 с. Анализ кривой плавления выполняли для определения идентичности амплифицированного продукта. Каждый образец анализировали в трех независимых лунках, и среднее значение использовали для получения значения Ct целевого гена для каждого образца. Уровень экспрессии гена Cl HSP60 для каждого образца нормализовали с помощью GAPDH, а относительную кратность экспрессии Cl HSP60 в других тестируемых тканях по сравнению с большой грудной мышцей при оптимальной температуре или в обработанных группах по сравнению с контрольными группами для каждого образца. тканей рассчитывали методом 2 −ΔΔCt (Schmittgen and Livak 2008).Значения ΔCt от 4 до 5 биологических повторностей использовали для статистического анализа, проведенного с использованием программного обеспечения SPSS 20 (IBM, Armonk, NY, USA). Односторонний дисперсионный анализ (ANOVA) с последующим тестом Тьюки-Крамера для множественных парных сравнений использовали для сравнения различий между тестируемыми тканями при оптимальной температуре или различий между группами с различным временем обработки для каждой тестируемой ткани в условиях стресса. P  < 0,05 считалось статистически значимым.

Иммуногистохимическое окрашивание

Для определения уровней экспрессии и местоположения белка Cl HSP60 в тестируемой ткани при оптимальной температуре был проведен анализ ИГХ.Вкратце, фиксированные ткани заливали парафином и делали обычные срезы толщиной 4 мкм. Все срезы ткани запекали при 60 °C в течение ночи, а затем депарафинизировали и регидратировали с использованием ксилола с последующей промывкой спиртом (10 мин на раствор). Активность эндогенной пероксидазы блокировали 0,3% перекисью водорода (H 2 O 2 ) в течение 30 мин. Затем поиск антигена включал кипячение предметных стекол в буфере этилендиаминтетрауксусной кислоты (ЭДТА; 1 ммоль/л; pH 9,0) в микроволновой печи в течение 10 мин.После блокировки 10% нормальной козьей сывороткой в ​​течение 30 мин срезы тканей инкубировали с разведенным первичным антителом против HSP60 (разведение 1:100; Proteintech, США) при 4°C в течение ночи. После промывания PBS эти предметные стекла инкубировали с меченым пероксидазой хрена вторичным антителом против IgG кролика (разведение 1:100; Dako, Glostrup, Дания) в течение 1 часа при комнатной температуре. Иммунореактивность визуализировали с помощью набора для разработки DAB (Beyotime, Китай) и промывали PBS. Наконец, ядра окрашивали гематоксилином.Срезы ткани сердца без первичных антител в процедуре окрашивания IHC использовали в качестве отрицательного контроля, а слайды с аденокарциномой легкого человека использовали в качестве положительного контроля. Изображения были получены и проанализированы с использованием цифрового сканера слайдов NanoZoomer с программным обеспечением NDP.view2 (Hamamatsu Photonics, Hamamatsu, Japan).

Вестерн-блоттинг

Вестерн-блоттинг использовали для определения изменений Cl HSP60 на уровне белка. Пятьдесят миллиграммов замороженной ткани гомогенизировали в лизирующем буфере для анализа радиоиммунопреципитации (RIPA) (Beyotime, WuHan, Китай) для извлечения белка, который затем определяли количественно с использованием набора для анализа белка BCA (Thermo Fisher Scientific, Уолтем, Массачусетс, США). Белковые экстракты (40 мкг) для каждого образца разделяли на полиакриламидном геле с 10% додецилсульфатом натрия (SDS-PAGE) и переносили на мембраны из поливинилиденфторида (PVDF) (Millipore, Бедфорд, Массачусетс, США). Мембраны блокировали 5% обезжиренным молоком в течение 1 ч при 37°С, а затем инкубировали с разведенными первичными антителами против HSP60 (разведение 1:3000; Proteintech, США) и GAPDH (разведение 1:10000; Sungene, Китай) в течение ночи при 4 °С. Затем мембраны промывали трис-буферным солевым раствором, содержащим Tween 20 (TBST), четыре раза (каждый раз по 10 мин), а затем инкубировали со вторичными антителами против кроличьего IgG (разведение 1:20 000; Sungene, Китай) или мышиного IgG ( разведение 1:10 000; Sungene, Китай) в течение 1 ч при 37 °C.Наконец, полосы белка были обнаружены с использованием набора для обнаружения вестерн-блоттинга ECL (Thermo Fisher Scientific, Waltham, MA, USA) с помощью системы визуализации Amersham Imager 600 (GE, Pittsburgh, PA, USA). Значения серого для белковых полос анализировали с использованием программного обеспечения ImageJ 1. 46r. Среднее отношение значения серого Cl HSP60 к GAPDH из трех биологических повторов использовали для статистического анализа, который выполняли, как описано выше для количественной ПЦР.

Результаты

Молекулярная характеристика гена ClHSP60

Полная последовательность кДНК Cl HSP60 была получена с помощью RACE и гнездовой ПЦР-амплификации (GenBank Accession No.{«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»MN8″,»term_id»:»1842959335″,»term_text»:»MN8″}}MN8). Длина последовательности составила 2257 п.н., состоящей из 5′-нетранслируемой области (UTR) длиной 72 п.н., ORF из 1722 п.н. и 3′-UTR из 463 п.н. с типичной сигнальной последовательностью полиаденилирования AATAAA, расположенной в положениях 19–24. -nt перед поли(А)-хвостом (рис. ). Нуклеотидный состав ОРС был А (520, 30,25%), Т (365, 21,23%), Г (495, 28,80%) и С (339, 19,72%), при этом содержание GC 48,52% было ниже, чем В (51.48%).), а GC- и AT-асимметрия составляли 0,19 и 0,18 соответственно (дополнительная таблица 1). GC1 (58,81%) был выше, чем AT1 (41,19%), а GC2 (38,22%) был заметно ниже, чем AT2 (61,78%), а GC3 (48,52%) был немного ниже, чем AT2 (51,48%). Сходные особенности нуклеотидного состава выявлены и у других позвоночных, за исключением остеихтов, особенно в третьем участке кодона.

Молекулярные структуры Cl гена HSP60. и Cl Положение гена HSP60 на хромосоме домашнего голубя. b Молекулярная структура Cl гена HSP60. Прямоугольники представляют экзоны с проиллюстрированной длиной. ORF и UTR были обозначены черным и белым прямоугольником соответственно. Линии сгиба обозначают интроны с отображаемой длиной. c Аминокислота и полипептид Cl HSP60. Арабские цифры обозначают сайты аминокислот, а прямоугольники разного цвета обозначают структурно разные домены. d Трехмерная модель мономера Cl HSP60 показывает три домена: апикальный (синий), промежуточный (желтый) и экваториальный (зеленый)

Выравнивание кДНК с геномом домашних голубей, в котором частично отсутствуют фрагменты Ген Cl HSP60 был амплифицирован и секвенирован, результаты показали, что ген Cl HSP60 расположен на хромосоме 6 с полной длиной 7162 п. н. и имеет 12 экзонов длиной от 65 до 590 п.н. и 11 интронов длиной от от 91 до 1685 п.н. (рис.). Полипептид с расчетной молекулярной массой 60,97 кДа, теоретической изоэлектрической точкой (pI) 5,60, расчетным периодом полураспада 30 часов и расчетным индексом нестабильности (II) 29,57 содержал митохондриальную предварительную последовательность из 26 аминокислот в N- конце, типичный митохондриальный сигнатурный мотив семейства HSP60 (AAVEEGIVPGGG) в положении остатков 430–441, сайты связывания ATP/Mg 2+ , сегмент 215-EGMKFDRGYISPY-227, включающий сайты связывания субстрата, и консервативный повторяющийся мотив GGM в конце С-терминал (рис.). Среди них митохондриальная препоследовательность, необходимая для импорта в митохондрии, была менее консервативной, и было отмечено, что только в мотиве повтора GGM у черепах было три делеции аминокислот. Кроме того, с помощью программы SignalP в полипептиде не были обнаружены сигнальные пептиды, но были обнаружены некоторые сайты фосфорилирования (например, 70S, 90Y, 164T, 383S, 549Y). Мы также предсказали вторичную структуру Cl HSP60, и также были обнаружены четыре конформации: α-спираль, удлиненная цепь, β-виток и случайный клубок с пропорциями 54.45%, 12,57%, 8,73% и 24,26% соответственно. Оптимальной матрицей для моделирования гомологии был человеческий белок HSP60 (идентификатор PDB: 4pj1.1) с гомологией 94,14%. Трехмерная структура Cl HSP60 без остатков в недопустимой области и с G-фактором - 0,23 охватывает три важных домена, названных апикальным (остатки 217–400 позиции), экваториальным (остатки 27–160, 437–550). позиции) и промежуточные (остатки 161–216, 401–436 позиции), связывающие апикальный и экваториальный домены (рис.).

Мы также исследовали использование кодонов Cl HSP60. Результаты показали, что присутствовали 20 обычных аминокислот позвоночных, и в основном использовались Ala, Val, Gly и Lys, в то время как Cys, His и Trp использовались меньше (рис. ). Кроме того, использовались все 61 кодон, за исключением стоп-кодона, в котором использование синонимичных кодонов было несколько неравномерным (RSCU, от 0,26 до 1,80), и только пять кодонов (CCA, CTG, TCT, TCG и AGA) широко использовались (RSCU > 1,6). Значение CAI по сравнению с моделью использования геномных кодонов голубя равнялось 0.71, что предсказывало низкий уровень экспрессии генов.

Относительное использование синонимичных кодонов (RSCU) Cl гена HSP60. Семейства и номера кодонов показаны на оси X и Y соответственно. Числа с десятичной точкой указывают значения RSCU. , включая сигнатурный мотив HSP60 и сайты связывания ATP/Mg 2+ . Cl HSP60 продемонстрировал высокое сходство последовательностей с другими птицами со средней идентичностью 91% и средним генетическим расстоянием 0,11 (дополнительная таблица 2), а также в среднем 85%, 82%, 78%, 74%, 66 % и 49%, соответствующие нуклеотидным последовательностям рептилий, млекопитающих, амфибий, костных, беспозвоночных и бактерий. Идентичность аминокислотной последовательности была выше.

Выполненное выравнивание было использовано для построения филогенетических деревьев. Деревья ML и NJ имеют одну и ту же топологию с разными значениями начальной загрузки, поэтому на рис. . Результаты показывают, что последовательности HSP60 для всех животных сгруппированы со значением начальной загрузки 100%, а монофилия позвоночных привела к пяти монофилетическим группам, включая остеихтов, земноводных, рептилий, птиц и млекопитающих, в которых клада млекопитающих была сестрой рептилий. и ave клады. Columba livia , расположенный в кладе aves, был сестрой Streptopelia turtur (начальное значение 100%), что позволяет предположить, что они имели самое близкое филогенетическое родство, которое также подтверждалось 98% парной идентичностью последовательностей.

Филогенетическое дерево максимальной вероятности (ML) из 30 животных с двумя бактериями в качестве внешних групп. Этот анализ был основан на нуклеотидных последовательностях Cl гена HSP60, а инвентарные номера GenBank перечислены в дополнительной таблице 1. Были указаны значения начальной загрузки ML для разных узлов, а значения менее 50% не показаны. экспрессия гена ClHSP60

Для изучения тканедифференциальной экспрессии гена Cl HSP60 мы получили девять различных тканей домашних голубей при оптимальной температуре (25 °C) и относительные различия экспрессии Cl HSP60 при транскрипции и уровни белка исследовали с помощью ИГХ, количественной ПЦР и вестерн-блоттинга соответственно. Полученные данные показали, что ген Cl HSP60 конститутивно экспрессировался в цитоплазме во всех протестированных тканях (рис. ). Относительные уровни экспрессии Cl HSP60 по отношению к эталонному гену GAPDH на уровне транскрипции и белка представлены соответственно на рис. и с постепенно уменьшающейся экспрессией в печени, почках, кишечнике, легких, зобе, желудке, сердце, головном мозге и большой грудной мышце. По сравнению с самым низким относительным уровнем экспрессии в большой грудной мышце среднее кратное изменение относительного уровня мРНК Cl HSP60 из биологических повторов составило 30.в 80 раз ( P  < 0,05) в печени, что было самым высоким, и в 10,39 раза в сердце ( P  < 0,05), при этом статистически значимой разницы в относительных уровнях экспрессии не было. Cl HSP60 между другими тканями (рис. ).

Иммуногистохимический анализ Cl HSP60 во всех тестируемых тканях при оптимальной температуре (25 °C), включая a печень, b почку, c кишечник, d легкое, e 0 желудок, г сердце, ч головной мозг и i большая грудная мышца (масштабная линейка, 50 мкм) , легкое, зоб, желудок, сердце и головной мозг) по сравнению с таковым в большой грудной мышце при оптимальной температуре (25 °C), как было обнаружено с помощью количественной ПЦР и нормализовано с помощью гена GAPDH. Значения выражали как среднее значение ± стандартное отклонение ( n  = 5), а разные строчные буквы обозначали статистически значимые различия ( P  < 0,05) между тестируемыми тканями

Уровень экспрессии белка Cl HSP60 в печени, почка, кишечник, легкое, зоб, желудок, сердце, головной мозг и большая грудная мышца домашних голубей при оптимальной температуре (25 °C), согласно оценке вестерн-блоттинга с использованием GAPDH в качестве эталонного белка. a Представленный результат вестерн-блоттинга для Cl HSP60 и GAPDH. b Отношение значения серого для Cl HSP60 к GAPDH. Значения представлены как среднее ± стандартное отклонение ( n  = 3), а разные строчные буквы обозначают статистически значимые различия ( P  < 0,05) между тестируемыми тканями

Анализ экспрессии гена ClHSP60 при тепловом стрессе

Экспрессия уровни Cl HSP60 в ответ на острый тепловой стресс при 38 °C в различных тканях показаны на рис. а. По сравнению с контрольной группой (25°C) кратность изменения экспрессии Cl HSP60 в легких была максимальной, которая заметно увеличивалась в течение 2 ч после термического стресса и достигала пикового значения (7,33 раза) через 4 и 6 ч при нет существенной разницы через 8 ч. Более того, в большой грудной мышце уровень мРНК со временем постепенно увеличивался и достиг пикового значения (в 4,16 раза, P  < 0,05) через 8 ч после термического стресса. Кроме того, уровень мРНК в желудке, кишечнике и печени быстро достиг максимального уровня экспрессии (2.65-, 2,07- и 1,64-кратное, P  < 0,05) в течение 2 ч после применения термического стресса, а затем постепенно уменьшалось через 4, 6 и 8 ч. Однако не было значительного кратного изменения экспрессии Cl HSP60 в почках во время экспериментов с тепловым стрессом, и уровни экспрессии не снижались заметно (в 0,67 раза, P  < 0,05) в головном мозге до 6 ч после воздействия теплового стресса. . В сердце и зобе уровни экспрессии были значительно снижены ( p  < 0.05) через 2 и 4 ч при воздействии острого термического стресса и затем постепенно затухало через 6 и 8 ч.

Кратность изменения относительного уровня мРНК для Cl HSP60 в печени, почках, кишечнике, легких, зобе, желудке, сердце, головном мозге и большой грудной мышце при тепловом стрессе (38 °C) ( a ) и холоде стресс (5°C) ( b ) в течение 2, 4, 6 и 8 часов по сравнению с таковым в контрольной группе (25°C, оптимальная температура), как определено с помощью количественной ПЦР с использованием GAPDH в качестве гена внутреннего контроля.Величины представляли как среднее ± стандартное отклонение ( n  = 4–5), а относительный уровень мРНК в каждой ткани для разного времени воздействия температурного стресса соответственно анализировали на наличие статистически значимых различий, обозначенных разными строчными буквами ( P  < 0,05)

Анализ экспрессии гена ClHSP60 при холодовом стрессе

Относительные уровни мРНК Cl HSP60 при остром холодовом стрессе (5 °C) показаны на рис. b. Наибольшее увеличение экспрессии наблюдалось в большой грудной мышце, которая значительно активизировалась в течение 2 ч после применения холодового стресса и быстро достигала пикового значения (3.в 83 раза по сравнению с контролем) через 4 и 6 ч до снижения через 8 ч ( P  < 0,05) после холодового стресса. Уровни экспрессии мРНК в желудке и легких значительно повышались и соответственно достигали пиковых значений (в 2,79 и 1,75 раза, P  < 0,05) через 2 и 4 ч при воздействии холодового стресса, а затем постепенно снижались через 6 и 8 ч, экспрессия заметно снижена по сравнению с контрольной группой. Кроме того, экспрессия Cl HSP60 в почках также значительно повышалась ( P  < 0.05) через 4 и 6 ч, с пиковым значением в 1,54 раза через 4 ч, тогда как оно было несколько снижено (в 0,80 раз по сравнению с контролем) в течение 2 ч после воздействия острого холодового стресса. Кроме того, уровни экспрессии в кишечнике резко снижались через 2, 4 и 6 ч и слегка повышались (в 1,18 раза, 90 035 P  < 0,05) через 8 ч, в то время как экспрессия заметно снижалась в головном мозге и сердце в течение 2, 4, 6, и через 8 ч после применения острого холодового стресса ( P  < 0,05).

Обсуждение

HSP60 как член суперсемейства HSP играет ключевую роль в поддержании метаболизма и белкового гомеостаза (Cappello et al.2014; Лю и др. 2019). В настоящем исследовании полная последовательность кДНК Cl HSP60 была получена и охарактеризована из ткани домашнего голубя. Митохондриальная последовательность, сигнатурный мотив HSP60, сайты связывания ATP/Mg 2+ , сегмент для связывания субстрата и повторяющийся мотив GGM были обнаружены в последовательности Cl HSP60, которые были идентифицированы в HSP60 других видов ( Броккьери и Карлин, 2000 г., Каппелло и др., 2014 г., Денг и др., 2018 г., Ши и др., 2016 г., Ван и др.2012 г.; Сюй и др. 2011). Результаты нашего выравнивания последовательностей показали, что HSP60 является высококонсервативным, особенно в функциональных доменах или модулях, что также подтверждается предыдущими исследованиями (Brocchieri and Karlin 2000; Deng et al. 2018; Feder and Hofmann 1999) и Cl . HSP60 проявлял высокую идентичность последовательностей с другими известными последовательностями HSP60. Кроме того, было обнаружено, что вторичная структура Cl HSP60 с α-спиралью в качестве первичной конформации (54,45%) и третичная структура с тремя структурно различными доменами (апикальный, промежуточный и экваториальный домены) очень сходны с белком HSP60 человека ( Низемблат и др.2015). Вышеупомянутые результаты позволяют предположить, что Cl HSP60 является консервативным и функциональным белком, функция которого может быть аналогична функции других HSP60. Кроме того, было предсказано несколько возможных сайтов фосфорилирования в гене Cl HSP60, что предполагает, что белок может играть роль в передаче сигнала (Calderwood 2018; Wu et al. 2017). Накопленные данные подтвердили, что HSP60 локализован в цитозоле и ядре, а также в митохондриях (Kumar Singh et al.2015 г.; Ву и др. 2017). Однако в текущем исследовании не было отмечено явного сигнала ядерной локализации и сигнальных пептидов на гене HSP60. Механизмы ядерного импорта, посттрансляционной обработки и транспорта нуждаются в дальнейшем изучении.

Филогенетическое древо, основанное на нуклеотидной последовательности HSP60, согласуется с общепризнанным филогенетическим родством животных, поддерживая монофилию современных птиц и тесное филогенетическое родство Columba livia и Streptopelia turtur (Neornithes) (Prum et др.2015). Кроме того, дерево также показало, что ген HSP60 является ортологичным геном у животных и может выступать в качестве молекулярного маркера для филогенетических исследований. Однако ряд плохо поддерживаемых узлов требует большего количества генов и более крупной выборки таксонов для дальнейшей филогенетической характеристики. Смещение использования кодонов (CUB) является важной эволюционной особенностью генома, предоставляющей важную информацию для изучения эволюции организма, функции генов и экспрессии генов. Низкий CUB указывал на низкий уровень экспрессии HSP60, потому что во время трансляции мРНК будут использоваться некоторые редкие кодоны (Uddin and Chakraborty 2016), в то время как это может быть полезно для экспрессии генов в разных тканях, поскольку разные типы клеток имеют разные предпочтения в отношении кодонов. Чакраборти и др.2019). Результаты настоящего исследования показали, что ген Cl HSP60 имеет низкий CUB со значением CAI 0,71, что позволяет предположить, что ген может экспрессироваться во всех тканях на низком уровне, что было дополнительно подтверждено следующими экспериментами qPCR и IHC.

Анализ профилей экспрессии в тканях Cl HSP60 может помочь нам понять его биологическую функцию у птиц. В этом исследовании мы обнаружили, что мРНК Cl HSP60 конститутивно экспрессировалась во всех протестированных тканях при оптимальной температуре, что свидетельствует о том, что этот ген играет важную роль в поддержании основного клеточного гомеостаза у домашних голубей.Аналогичная конститутивная экспрессия была также зарегистрирована у некоторых других таксонов, таких как манильские моллюски (Ding et al. 2018), белый амур (Xu et al. 2011), утка-несушка (Wang et al. 2012), цыплята-бройлеры (Yan et al. 2009), буйволы (Sodhi et al. 2015), человек и мышь. В нормальных физиологических условиях основной функцией HSP60 является действие в качестве митохондриального молекулярного шаперона для поддержания стабильности его структуры и функции, а также его можно использовать в качестве антигена для участия в иммунной регуляции (Chatterjee and Burns 2017). Таким образом, из-за функциональных различий тканей или органов можно предсказать, что уровень экспрессии HSP60 будет различаться между тканями и будет выше в тканях, в большей степени зависящих от митохондрий и органов иммунной системы. В девяти протестированных тканях домашних голубей различия в экспрессии HSP60 могут быть результатом их функционального разнообразия. Уровень экспрессии Cl HSP60 был самым высоким в печени, органе, важном для иммунной системы, в то время как другие органы имеют различную зависимость от митохондриальной функции.Большая грудная мышца, отвечающая за полет птиц, показала самые низкие уровни экспрессии HSP60, вероятно, из-за ее относительно единственной метаболической способности в нормальных условиях. Уровни экспрессии в этой ткани могут увеличиваться после значительных упражнений или тренировок (Marino Gammazza et al. 2018).

Предыдущие исследования показали, что экспрессия HSP60 индуцируется различными стрессовыми состояниями, включая тепловой и холодовой стресс, для защиты клеток от повреждения, вызванного стрессом (Al-Zghoul et al. 2015 г.; Чжао и др. 2014). Следовательно, можно сделать вывод, что клетки или ткани были повреждены, когда экспрессия HSP60 была неизменной или даже снижалась при остром температурном стрессе. Наши данные показали, что разные ткани домашних голубей по-разному реагируют на острый температурный стресс. По сравнению с контрольной группой (25 °C, оптимальная температура) экспрессия гена Cl HSP60 претерпела примерно пять изменений при остром температурном стрессе в течение 2, 4, 6 и 8 часов. Первый паттерн заключался в том, чтобы сначала подняться и достичь пика, а затем упасть, что было похоже на реакцию HSP60 на другие стрессоры (Shi et al.2016), а остальные четыре модели должны были непрерывно расти, сначала падать, а затем расти, без существенных изменений и явного снижения соответственно. Первые два паттерна представляют реакцию Cl HSP60 на острый тепловой стресс в легких, большой грудной мышце, желудке, кишечнике, печени и на острый холодовой стресс в большой грудной мышце, желудке и легком, что позволяет предположить, что Cl Уровень мРНК HSP60 был повышен для поддержания правильной укладки белка при температурном стрессе (Oksala et al. 2014). В частности, изменение экспрессии мРНК Cl HSP60 было наиболее очевидным в легких и большой грудной мышце, что подчеркивает решающую роль этих двух тканей в регуляции температуры (Nilsson et al. 2016; Schmidt-Nielsen et al. 1969). Последние три паттерна наблюдались в ответ на острый тепловой стресс в почках, головном мозге, сердце и зобе и на острый холодовой стресс в почках, зобе, печени, кишечнике, головном мозге и сердце, что указывает на то, что уровни мРНК Cl HSP60 не менялись. значительно изменяются или даже снижаются при остром температурном стрессе.С точки зрения фолдинга белка эти три паттерна не были полезны для фолдинга белка и регуляции температуры в этих тканях, и они даже могли вызвать повреждение этих тканей, таких как ткани сердца и мозга, из-за значительного снижения Cl HSP60. мРНК. Кроме того, уровни мРНК Cl HSP60 снижались в большинстве протестированных тканей при холодовом стрессе, что подчеркивает необходимость понимания того, как ответы на острый холодовой стресс отличаются от ответов на острый тепловой стресс, которые обычно лучше охарактеризованы.

В заключение, полную последовательность кДНК Cl HSP60 клонировали из домашних голубей ( Columba livia ). Его молекулярные характеристики и профиль тканевой экспрессии также были проанализированы, и результаты показали, что Cl HSP60 экспрессируется конститутивно, что позволяет предположить, что этот ген необходим для поддержания гомеостаза у домашних голубей. Кроме того, для тестируемых тканей было обнаружено пять моделей изменений, указывающих на то, что разные ткани домашних голубей по-разному реагируют на острый температурный стресс.Урожай, мозг и сердце потенциально нуждаются в большей защите при остром температурном стрессе. Наши результаты могут помочь ученым лучше понять молекулярные механизмы регуляции температуры у птиц.

Дополнительный электронный материал

ESM 1 (35K, xlsx)

(XLSX 35 КБ)

Благодарности

Благодарим редактора и рецензентов за полезные комментарии.

Финансирование

Это исследование было проведено при финансовой поддержке Ключевой программы Фонда естественных наук высших учебных заведений Аньхой Китая (гранты №. KJ2016A735, KJ2017A252 и KJ2019A0426).

Соблюдение этических норм

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Сноски

Примечание издателя

Springer Nature остается нейтральной в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

Ссылки

  • Аль-Згул М.Б., Исмаил З.Б., Далаб А.Е., Аль-Рамадан А., Альтнайан Т.А., Аль-Рамадан С.Ю., Али А.М., Альбохадаим И.Ф., Аль Бусадах К.А., Эльджара А. и др.Экспрессия генов Hsp90, Hsp60 и HSF-1 в мышцах, сердце и мозге цыплят-бройлеров, подвергшихся термическому воздействию. рез. вет. 2015;99:105–111. [PubMed] [Google Scholar]
  • Angelier F, Parenteau C, Ruault S, Angelier N. Эндокринные последствия острого стресса при различных температурных условиях: исследование кортикостерона, пролактина и гормонов щитовидной железы у голубя (Columbia livia) Comp. Biochem Physiol A Mol Integr Physiol. 2016;196:38–45. [PubMed] [Google Scholar]
  • Ариэли Ю., Пелтонен Л., Офир Э.Охлаждение путем кожного испарения воды у акклиматизированного к теплу сизого голубя (Columba livia) Comp Biochem Physiol A Mol Integr Physiol. 2002; 131:497–504. [PubMed] [Google Scholar]
  • Барнас Г., Раутенберг В. Реакция дыхания на дрожь, вызванную внешним и центральным охлаждением у голубя. Pflugers Archiv: Европейский журнал физиологии. 1984; 401: 228–232. [PubMed] [Google Scholar]
  • Blom N, Sicheritz-Pontén T, Gupta R, Gammeltoft S, Brunak S. Прогнозирование посттрансляционного гликозилирования и фосфорилирования белков по аминокислотной последовательности.Протеомика. 2004; 4: 1633–1649. [PubMed] [Google Scholar]
  • Броккьери Л., Карлин С. Сохранение последовательностей HSP60 в отношении структуры, функции и эволюции. Белковая наука: публикация Белкового общества. 2000; 9: 476–486. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Bukau B, Horwich AL. Сопровождающие машины Hsp70 и Hsp60. Клетка. 1998; 92: 351–366. [PubMed] [Google Scholar]
  • Calderwood SK. Белки теплового шока и рак: внутриклеточные шапероны или внеклеточные сигнальные лиганды? Philos Trans R Soc Lond Ser B Biol Sci.2018;373:20160524. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Cappello F, Conway de Macario E, Marasa L, Zummo G, Macario AJ. Экспрессия Hsp60, новые локализации, функции и перспективы диагностики и терапии рака. Биология и терапия рака. 2008; 7: 801–809. [PubMed] [Google Scholar]
  • Каппелло Ф., Марино Гаммазза А., Палумбо Пиччонелло А., Кампанелла С., Пейс А., Конвей де Макарио Э., Макарио А.Дж. Hsp60-шаперонопатии и шаперонотерапия: мишени и агенты. Экспертное мнение по этим целям.2014;18:185–208. [PubMed] [Google Scholar]
  • Чакраборти С., Мазумдер Т.Х., Уддин А. Композиционная динамика и характер использования кодонов гена BRCA1 у девяти видов млекопитающих. Геномика. 2019;111:167–176. [PubMed] [Google Scholar]
  • Чаттерджи С., Бернс Т. Ф. (2017) Нацеливание на белки теплового шока при раке: многообещающий терапевтический подход. Int J Mol Sci 18 [бесплатная статья PMC] [PubMed]
  • Cooper MA, Washburn KW. Взаимосвязь температуры тела с привесом, потреблением корма и использованием корма у бройлеров в условиях теплового стресса.наук о птицеводстве. 1998; 77: 237–242. [PubMed] [Google Scholar]
  • Dahl J-U, Gray MJ, Jakob U. Контроль качества белков в условиях окислительного стресса. Дж Мол Биол. 2015; 427:1549–1563. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: больше моделей, новая эвристика и параллельные вычисления. Нат Методы. 2012;9:772. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • DeLano WL. Pymol: инструмент молекулярной графики с открытым исходным кодом. Информационный бюллетень CCP4 по кристаллографии белков.2002; 40:82–92. [Google Scholar]
  • Дэн И, Ху З, Чай З, Тан И З. Молекулярное клонирование генов белков теплового шока 60 (Hsp60) и 10 (Hsp10) космополитной и вредоносной динофлагелляты Scrippsiella trochoidea и их дифференциальная транскрипция в ответ на температурный стресс и изменение жизненного цикла. Мар биол. 2018;166:7. [Google Scholar]
  • Ding J, Li J, Yang D, Yang F, Nie H, Huo Z, Yan X. Молекулярные характеристики нового гена HSP60 и его дифференциальная экспрессия у манильских моллюсков (Ruditapes philippinarum) в условиях термического и гипотонического стресса .Шапероны клеточного стресса. 2018;23:179–187. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Domyan ET, Shapiro MD. Пиджеонетика в полете: эволюция, развитие и генетика внутривидовой изменчивости. Дев биол. 2017; 427: 241–250. [Статья бесплатно PMC] [PubMed] [Google Scholar]
  • Fang Y-C, Cheng M. Влияние C-концевых мутаций HSP60 на фолдинг белка. J биомедицинских наук. 2002; 9: 223–233. [PubMed] [Google Scholar]
  • Feder ME, Hofmann GE. Белки теплового шока, молекулярные шапероны и реакция на стресс: эволюционная и экологическая физиология.Annu Rev Physiol. 1999; 61: 243–282. [PubMed] [Google Scholar]
  • Франк А., Лобри Дж. Паттерны асимметричных замен: обзор возможных основных мутационных или селективных механизмов. Ген. 1999; 238: 65–77. [PubMed] [Google Scholar]
  • Geourjon C, Deleage G. SOPMA: значительные улучшения в прогнозировании вторичной структуры белка путем консенсусного прогнозирования на основе множественных выравниваний. Биоинформатика. 1995; 11: 681–684. [PubMed] [Google Scholar]
  • Граф Р. Суточные изменения терморегуляторных функций у голубей.I Эффекторные механизмы Архив Пфлюгера: Европейский журнал физиологии. 1980; 386: 173–179. [PubMed] [Google Scholar]
  • Grundtman C, Kreutmayer SB, Almanzar G, Wick MC, Wick G. Белок теплового шока 60 и иммунные воспалительные реакции при атеросклерозе. Артериосклеры Тромб Васк Биол. 2011; 31: 960–968. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hall TA (1999) BioEdit: удобный редактор выравнивания биологических последовательностей и программа анализа для Windows 95/98/NT
  • Hansen PJ.Влияние теплового стресса на репродукцию млекопитающих. Философские труды Королевского общества B: Биологические науки. 2009; 364:3341–3350. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Heiserman JP, Chen L, Kim BS, Kim SC, Tran AL, Siebenborn N, Knowlton AA. Мутация TLR4 и HSP60-индуцированная гибель клеток в кардиальных миоцитах взрослых мышей. Шапероны клеточного стресса. 2015; 20: 527–535. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Хеллер Х.К., Граф Р., Раутенберг В. Влияние циркадного ритма и состояния возбуждения на терморегуляцию у голубя.Am J Phys. 1983; 245: Р321–Р328. [PubMed] [Google Scholar]
  • Холт С., Кэмпбелл М., Кейс Д.А., Эдельман Н., Капуста А., Маклари Э., Э. Т.Д. Сух А., Уоррен В.К., Янделл М. и др. Улучшенная сборка и аннотация генома сизого голубя ( Columba livia ) G3 (Bethesda) 2018;8:1391–1398. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jones ME, Button DJ, Barrett PM, Porro LB. Цифровая диссекция головы сизого голубя (Columba livia) с помощью компьютерной томографии с контрастным усилением.Зоологические письма. 2019;5:17. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Kampinga HH, Hageman J, Vos MJ, Kubota H, Tanguay RM, Bruford EA, Cheetham ME, Chen B, Hightower LE. Руководство по номенклатуре белков теплового шока человека. Шапероны клеточного стресса. 2009; 14:105–111. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Kan X, Li XF, Zhang LQ, Chen L, Qian CJ, Zhang X, Wang L. Характеристика полного митохондриального генома сизого голубя, Columba livia (Columbiformes : Columbidae) Genet Mol Res.2010;9:1234–1249. [PubMed] [Google Scholar]
  • Katoh K, Standley DM. Программное обеспечение MAFFT для множественного выравнивания последовательностей, версия 7: улучшения производительности и удобства использования. Мол Биол Эвол. 2013;30:772–780. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Кумар Сингх М., Джанардан Редди П.В., Сридхар А.С., Тивари П.К. Молекулярная характеристика и анализ экспрессии гомолога гена hsp60 овечьей мясной мухи Lucilia cuprina. Дж Терм Биол. 2015;52:24–37. [PubMed] [Google Scholar]
  • Кумар С., Стечер Г., Ли М., Княз С., Тамура К.MEGA X: молекулярно-эволюционный генетический анализ на вычислительных платформах. Мол Биол Эвол. 2018;35:1547–1549. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Li M, Wang XS, Xu FP, Liu S, Xu SW, Li S. Изменение экспрессии белка теплового шока в нейротоксичности, вызванной авермектином, у голубя (Columba livia) как in vivo, так и in vitro. Экотоксикол Environ Saf. 2014; 110:95–102. [PubMed] [Google Scholar]
  • Линдквист С. Реакция на тепловой шок. Анну Рев Биохим. 1986; 55: 1151–1191.[PubMed] [Google Scholar]
  • Liu B, Li S, Xiu B, Zhang Y, Yang Q, Qi W, Wu W, Wang L, Gu J, Xie J. С-конец белка теплового шока 60 может активировать макрофаги. с помощью лектиноподобного рецептора окисленных липопротеинов низкой плотности 1. Biochem Biophys Res Commun. 2019;508:1113–1119. [PubMed] [Google Scholar]
  • Livak KJ, Schmittgen TD. Анализ данных об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2- ΔΔCT. Методы. 2001; 25: 402–408. [PubMed] [Google Scholar]
  • Марино Гаммазза А., Макалузо Ф., Ди Феличе В., Капелло Ф., Бароне Р.Hsp60 в скелетных мышцах Биогенез и гомеостаз волокон: от физических упражнений до патологии скелетных мышц. Клетки. 2018;7:224. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Мартинес-Пас П., Моралес М., Мартин Р., Мартинес-Гитарте Дж. Л., Морсильо Г. Характеристика гена малого белка теплового шока Hsp27 у Chironomus riparius (Diptera) и его профиль экспрессии в ответ на изменения температуры и воздействие ксенобиотиков. Клеточный стресс и шапероны. 2014; 19: 529–540. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Motojima F.Как шаперонины сворачивают белок? Биофизика (Нагоя-ши, Япония) 2015; 11:93–102. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Некер Р., Раутенберг В. Влияние деафферентации позвоночника на терморегуляцию и термочувствительность позвоночника у голубей. Pflugers Archiv: Европейский журнал физиологии. 1975; 360: 287–299. [PubMed] [Google Scholar]
  • Nilsson J-Å, Molokwu MN, Olsson O. Регулирование температуры тела в жарких условиях. ПЛОС Один. 2016;11:e0161481. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Нисемблат С., Янив О., Парнас А., Фролов Ф., Азем А.Кристаллическая структура митохондриального шаперонинового симметричного футбольного комплекса человека. Proc Natl Acad Sci U S A. 2015;112:6044–6049. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Оксала Н.К., Экмекчи Ф.Г., Озой Э., Киранкая С., Коккола Т., Эмецен Г., Лаппалайнен Дж., Каарниранта К., Аталай М. Естественная тепловая адаптация увеличивает уровень белка теплового шока и уменьшает окислительный стресс. Редокс Биол. 2014; 3:25–28. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Peltonen L, Arieli Y, Harjula R, Pyörnilä A, Marder J.Местный кожный водный барьер у акклиматизированных к холоду и теплу голубей (Columba livia) в зависимости от испарения воды через кожу. J Морфол. 2000; 246:118–130. [PubMed] [Google Scholar]
  • Prum RO, Berv JS, Dornburg A, Field DJ, Townsend JP, Lemmon EM, Lemmon AR (2015) Комплексная филогения птиц (Aves) с использованием целевого секвенирования ДНК следующего поколения. Nature 526(7574):569–573 [PubMed]
  • Puigbò P, Bravo IG, Garcia-Vallve S. CAIcal: комбинированный набор инструментов для оценки адаптации использования кодонов.Биол Директ. 2008;3:38. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Schmidt-Nielsen K, Kanwisher J, Lasiewski RC, Cohn JE, Bretz WL. Терморегуляция и дыхание у страуса. Кондор. 1969; 71: 341–352. [Google Scholar]
  • Schmittgen TD, Livak KJ. Анализ данных ПЦР в реальном времени сравнительным методом C(T). Нат Проток. 2008;3:1101–1108. [PubMed] [Google Scholar]
  • Shapiro MD, Domyan ET. Домашние голуби. Текущая биология: КБ. 2013; 23: Р302–Р303. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Shapiro MD, Kronenberg Z, Li C, Domyan ET, Pan H, Campbell M, Tan H, Huff CD, Hu H, Vickrey AI. Геномное разнообразие и эволюция гребня на голове у сизого голубя. Наука. 2013; 339:1063–1067. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Shi J, Fu M, Zhao C, Zhou F, Yang Q, Qiu L. Характеристика и анализ функций Hsp60 и Hsp10 при различных острых стрессах у черной тигровой креветки, Penaeus монодон. Клеточный стресс и шапероны. 2016;21:295–312. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Shpilka T, Haynes CM. Митохондриальный UPR: механизмы, физиологические функции и последствия старения.Nat Rev Mol Cell Biol. 2018;19:109–120. [PubMed] [Google Scholar]
  • Сильвестро Д., Михалак И. raxmlGUI: графический интерфейс для RAxML. Разнообразие и эволюция организмов. 2012;12:335–337. [Google Scholar]
  • Sodhi M, Kishore A, Sharma A, Shandilya U, Kumari P, Mukesh M. Дифференциальная экспрессия белков теплового шока в тканях речных буйволов. Индийский журнал наук о животных. 2015;85(4):397–403. [Google Scholar]
  • Sørensen JG, Kristensen TN, Loeschcke V. Эволюционная и экологическая роль белков теплового шока. Эколь Летт. 2003;6(11):1025–1037. [Google Scholar]
  • Субраманиан Б., Гао С., Лерчер М.Дж., Ху С., Чен У.Х. Evolview v3: веб-сервер для визуализации, аннотирования и управления филогенетическими деревьями. Нуклеиновые Кислоты Res. 2019;47:W270–w275. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Уддин А., Чакраборти С. Тенденция использования кодонов в митохондриальном гене CYB. Ген. 2016; 586:105–114. [PubMed] [Google Scholar]
  • Wang D, Lu L, Tian Y, Li J, Shen J, Tao Z, Li G, Xu N.Молекулярное клонирование, характеристика и характер экспрессии белка теплового шока 60 (HSP60) у несушек (Anas platyrhynchos) Can J Anim Sci. 2012;92:425–432. [Google Scholar]
  • Wu J, Liu T, Rios Z, Mei Q, Lin X, Cao S. Белки теплового шока и рак. Trends Pharmacol Sci. 2017; 38: 226–256. [PubMed] [Google Scholar]
  • Xia X. DAMBE7: новые и улучшенные инструменты для анализа данных в молекулярной биологии и эволюции. Мол Биол Эвол. 2018;35:1550–1552. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Xie J, Tang L, Lu L, Zhang L, Xi L, Liu HC, Odle J, Luo X.Дифференциальная экспрессия факторов транскрипции теплового шока и белков теплового шока после острого и хронического теплового стресса у кур-несушек (Gallus gallus) PLoS One. 2014;9:e102204–e102204. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Xu XY, Shen YB, Fu JJ, Liu F, Guo SZ, Yang XM, Li JL. Молекулярное клонирование, характеристика и характер экспрессии HSP60 у белого амура (Ctenopharyngodon idella) Иммунология рыб и моллюсков. 2011; 31: 864–870. [PubMed] [Google Scholar]
  • Yan J, Bao E, Yu J.Экспрессия белка теплового шока 60 в сердце, печени и почках бройлеров, подвергшихся воздействию высокой температуры. рез. вет. 2009; 86: 533–538. [PubMed] [Google Scholar]
  • Ye M, Zhou B, Wei S, Ding M, Lu X, Shi X, Ding J, Yang S, Wei W. Транскриптомный анализ идентифицирует гены-кандидаты, связанные с внутримышечным отложением жира и составом жирных кислот. в грудной мышце тыквы (Columba) G3 (Bethesda) 2016;6:2081–2090. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Yoshimoto H, Takeo T, Nakagata N.Диметилсульфоксид и кверцетин продлевают выживаемость, подвижность и фертильность сперматозоидов мышей, хранящихся на холоду, на 10 дней. Биол Репрод. 2017; 97: 883–891. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zhao Q, Wang J, Levichkin IV, Stasinopoulos S, Ryan MT, Hoogenraad NJ. Митохондриальная специфическая реакция на стресс в клетках млекопитающих. EMBO J. 2002; 21: 4411–4419. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zhao FQ, Zhang ZW, Qu JP, Yao HD, Li M, Li S, Xu SW. Холодовой стресс индуцирует антиоксиданты и Hsps в иммунных органах цыплят.Шапероны клеточного стресса. 2014; 19: 635–648. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zhou A, Xie S, Wang Z, Chen Y, Zhang Y, Fan L, Zeng F, Zou J. Профиль экспрессии HSP60 при различных экстремальных температурных стрессах у северного змееголова-альбиноса , Чанна Аргус. Клеточный стресс и шапероны. 2018;23:791–796. [Статья бесплатно PMC] [PubMed] [Google Scholar]
  • Zhu Y, Lu X, Wu D, Cai S, Li S, Teng X. Влияние цитотоксичности, вызванной марганцем, на экспрессию мРНК HSP27, HSP40, HSP60, HSP70 и HSP90 в лимфоцитах селезенки кур in vitro.Биол Трейс Элем Рез. 2013; 156: 144–152. [PubMed] [Google Scholar]

Художница Элизабет Коломба раскрывает скрытые фигуры искусства крупным планом

Дождливое утро в Париже 1863 года. зонтик, смотрит прямо с холста. Я нахожусь в мастерской Элизабет Коломба, художницы французского происхождения из Нью-Йорка, и это картина, которую она только что закончила. Чуть позади центральной фигуры карета, запряженная лошадьми, везет хорошо одетого белого мужчину с букетом цветов в руках.Слева от нее молодая женщина в розовом платье и ее крошечная собачка собираются войти в здание, а на заднем плане няня и две маленькие девочки направляются в парк. Черную женщину зовут Лаура, и она направляется в студию Эдуарда Мане, который использует ее в качестве модели горничной в Олимпия , исторической картине, которая потрясла Париж и возвестила о приходе современного искусства.

Картина Коломбы могла быть написана в 1860-х годах. Она новый тип художника-историка, привлекательная, застенчивая, но очень амбициозная художница в свои 40, рассказывающая истории о чернокожих женщинах — обычно реальных, но иногда воображаемых — которые жили в более ранние эпохи.Ее карьера на сегодняшний день была в значительной степени вне поля зрения, но, как и Лора Мане, она находится на грани того, чтобы быть обнаруженной. С нашим растущим интересом к расовой идентичности ее нынешнее внимание к переопределению роли черных фигур в истории западной живописи привлекает внимание мира искусства. В роли горничной в «Олимпии » Мане Лора преподносит большой букет цветов, присланный клиентом обнаженной куртизанки, лежащей на флотилии белых подушек. (Это цветы, которые мы видим в карете, запряженной лошадьми.) О куртизанке известно очень много: это Викторина Мёран, любимая модель Мане и Дега, и сама художница. (Она является героем «Молодой леди» Мане в 1866 и обнаженной в его Le Déjeuner sur l’herbe . ) О Викторине были написаны диссертации и романы, но до сих пор ее черная копия в Олимпия — то есть на самом деле двойной портрет — был анонимным.

«Я рисую картины, основанные на реальных персонажах, людях, которые известны, потому что они изображены на знаменитых картинах», — говорит мне Элизабет на своем английском с французским акцентом.Под «известным» она подразумевает узнаваемого, но без имен или личностей. «Я вырываю их из этого контекста и даю им полную сцену. В то время, когда Мане писал « Олимпия », я представлял себе, что Лора, должно быть, шла в мастерскую Мане, поэтому вы видите ее на улице с зонтиком и красивыми воротами парка Монсо позади нее. Я даю ей центральную сцену и легкость бытия, которой, я не уверен, она обладала в то время». Рабство было окончательно отменено во Французской империи в 1848 году, и чернокожие женщины только начинали обретать независимость в нескольких областях — в качестве нянек, прислуги и моделей для художников.

«Женщина в розовом платье — это Кора Перл, — продолжает Элизабет, — которая стала самой известной куртизанкой Парижа.

Добавить комментарий

Ваш адрес email не будет опубликован.