Взгляды витте и плевелы таблица:  Сформулируйте основное разногласие в видении путей развития Росии С.Ю.Витте и В.К.Плеве. Что  — Школьные Знания.com

Содержание

2.3 Взгляды С.Ю. Витте и В.К. Плеве. Внутренняя политика Николая II с конца ХIХ века до начала ХХ века

Похожие главы из других работ:

Витте: биография

5.2 Посольская миссия Витте

Однако звездный час Витте, пик его карьеры и успеха наступил в революционном 1905 году. Под влиянием военных неудач в далекой Маньчжулии росло недовольство в стране. Оно проявлялось и в оппозиционном то не прессы...

Исторические подходы к регулированию экономики в России в период с 1896 г. до 1941 г.

1.1.1 Деятельность С.Ю. Витте

На пути к реальным переменам стояли два основных препятствия: первое -- слабость и неустойчивость внутреннего рынка, обусловленные крайне низкой покупательной способностью народных масс...

Кабинет министров С.Ю. Витте

Глава 3. Деятельность Витте во главе Комитета министров

Ситуация на-чала меняться с восшествием на престол Николая II. Последнему не были приятны манеры министра финансов. Все это наряду с нараставшими расхождениями по ря-ду важных аспектов внутренней и внешней политики...

Конфликт реформаторов - Витте и Столыпин

Глава I. Сравнительная характеристика жизни и деятельности С.Ю.Витте и П.А. Столыпина

...

Конфликт реформаторов - Витте и Столыпин

1.1 Сравнительно-биографический очерк С.Ю.Витте и П.А. Столыпина

Некоторые события в жизни могут сильно изменить или повлиять на становление характера человека и, тем самым, поменять всю судьбу. Рассмотрев биографии С. Ю.Витте и П. А. Столыпина, мы сможем выяснить, как прошло их детство...

Конфликт реформаторов - Витте и Столыпин

1.2 Сравнение политико-реформаторской деятельности С.Ю.Витте и П.А. Столыпина

Вопрос о политической деятельности Витте и Столыпина является наиболее изученным, из аспектов, затронутых в данной работе. Количество исследований уже давно исчисляется десятками наименований. Попробуем выделить самое основное. ..

Конфликт реформаторов - Витте и Столыпин

1.3 Сравнение личностных характеристик С.Ю.Витте и П.А. Столыпина

Итак, какими людьми были С.Ю Витте и П.А.Столыпин: их характер, отношения с близкими и просто знакомыми, наконец, какими их видели другие политические деятели и народ. Ответить на эти вопросы помогут мемуары, письма...

Модернизация страны в конце ХIХ – начале ХХ вв.

1. Преобразовательная деятельность С. Ю. Витте : основные направления, итоги .

С. Ю. Витте родился в Тифлисе 17 июня 1849 года и воспитывался в семье своего деда А. М. Фадеева , тайного советника , бывшего в 1841-1846 годах саратовским губернатором...

Отечественная история

Вопрос №2 Индустриализация при И.В. Сталине и С.Ю. Витте

Индустриализация при И.В. Сталине. В апреле 1929 г. состоялась XVI партконференция. Из двух вариантов пятилетнего плана (на 1928/29 - 1932/33 гг.), разработанных Госпланом СССР, она одобрила первый. Задания по нему были на 20% выше. "Нет таких крепостей...

Первая мировая война и модификации в государственном строе России

1.1 Изменение государственного устройства России и реформы Витте-Столыпина

Одним из главных результатов революции стало изменение государственного устройства России. Именно поэтому она была революцией (хотя это пытаются отрицать некоторые западные историки и их сторонники в отечественной публицистике)...

Реформы С.Ю. Витте

2 С.Ю. Витте - краткая биография

С.Ю.Витте родился в Тифлисе 17 июня 1849 года и воспитывался в семье своего деда А.М.Фадеева, тайного советника, бывшего в 1841-1846 гг. саратовским губернатором...

Реформы С.Ю. Витте

3. Основные направления преобразований С.Ю.Витте

Денежная реформа. Одной из главных заслуг С.Ю. Витте была стабилизация финансовой системы страны. Дело в том, что к 1890-м годам эта система была почти полностью расстроена, бумажные деньги были неустойчивыми вследствие их необеспеченности. ..

Реформы С.Ю. Витте

4. С.Ю. Витте как дипломат

С именем С.Ю. Витте связаны события и на международной арене, в которых участвовала Россия. В конце XIX - начале XX веков молодые, быстро развивающиеся страны (Германия, США, Япония)...

Россия в конце XIX - начале XX веков

7. Реформы С.Ю. Витте

Витте оказывал значительное влияние на внутреннюю и внешнюю политику русского правительства, активно содействовал развитию российского капитализма и пытался сочетать этот процесс с укреплением монархии...

Социально-экономическое развитие истории России к концу XIX-началу XX века

2.2 Экономические реформы С.Ю. Витте

Сергей Юльевич Витте (1849 - 1915гг.) был талантливым финансистом, реформатором и организатором экономики в России ( Приложение 3). В возрасте 43 лет Витте С.Ю. стал министром финансов с очень широкими полномочиями: ему были подчинены торговля...

Вячеслав Константинович Плеве | Государственное управление в России в портретах

Вячеслав Константинович фон Плеве

Вячеслав Константинович Плеве (1846 — 1904) — директор департамента полиции (1884), сенатор (1884 — 1894 ), государственный секретарь и главно-управляющий кодификационной частью при Государственном совете (1894), министр, статс-секретарь по делам Финляндии (1889), министр внутренних дел (1902) и шеф отдельного корпуса жандармов (1902).

Проводил политику разложения революционного движения изнутри, подавления стачек и крестьянских восстаний. Убит социалистом-революционером Е.Сазоновым в С.-Петербурге.

Родился в г. Мещовске Калужской губ. Его отец К. Г. фон Плеве происходил из семьи обрусевших православных немцев и был учителем истории и географии в местной гимназии. Мать, Елизавета Михайловна, урожденная Шамаева, происходила из калужских мелкопоместных дворян. Т. о., несмотря на свое дворянское происхождение, Плеве вышел из «умственного пролетариата»  низшей части провинциальной интеллигенции. Все, чего добился Плеве, он добился сам, не имея ни титула, ни денег, ни протекции. Окончив калужскую гимназию с золотой медалью, Плеве поступил на юридический факультет Московского университета, который закончил в 1867, получив степень кандидата права. Поступив на службу в министерство юстиции, Плеве последовательно занимал должности товарища прокурора во владимирском, затем тульском окружных судах, прокурора в Вологде, товарища прокурора Варшавской судебной палаты.

В 1879 был назначен прокурором Петербургской судебной палаты. Александр II обратил внимание М. Т. Лорис-Меликова на Плеве, обладавшего исключительной памятью и работоспособностью.

И. Е. РЕПИН. Арест пропагандиста

На посту петербургского прокурора он оказался в момент острого политического кризиса рубежа 1870—80-х, когда развернулся террор народовольцев, либеральная интеллигенция громко требовала «увенчания здания» Империи конституцией. В таких условиях от Плеве требовались уже не только многократно проявленные им на службе энергия, компетентность и работоспособность, но и надо было твердо определиться, на какой стороне находиться в развернувшейся борьбе. Без колебаний молодой юрист встал на сторону православно-монархической России. Как прокурор Плеве принимал участие в расследовании взрыва в Зимнем Дворце 5 февр. 1880, осуществленном С. Халтуриным. Тогда произошло близкое знакомство Плеве с Наследником, будущим Александром III. На Цесаревича произвели благоприятное впечатление деловитость, собранность и феноменальная память Плеве, который без всяких записей держал в уме сотни обстоятельств дела.

Худ. Якоби В. И. Привал арестантов. 1861
Холст, масло, 98 x 143. Государственная Третьяковская галерея

Сразу после цареубийства 1 марта 1881, 35-ти лет от роду, Плеве возглавил Департамент полиции МВД. В условиях жестокой политической борьбы этот пост был очень ответственным и опасным. Сам Департамент в это время переживал постоянные реорганизации и перестройки, которые проводили сменявшие друг друга в 80-е три министра. Более того, Департамент полиции до Плеве не занимался непосредственно борьбой с политической оппозицией (это было прерогативой Третьего Отделения и корпуса жандармов), а ведал поддержанием общественного порядка, содержанием тюрем, дезертирами, фальшивомонетчиками и т. п.

Но в 1880 дела и полномочия Третьего Отделения были переданы в Департамент полиции. Плеве предстояло создать из нескольких разрозненных ведомств единую структуру в разгар борьбы с революционным движением. Плеве полностью оправдал возложенные на него надежды, разгромив к 1884 народовольцев. Плеве привлек к службе в Департаменте молодых образованных специалистов, назначая на должности не по знатности или старшинству, а по способностям. Он отличался умением подбирать и расставлять кадры так, чтобы получать максимальную отдачу от каждого своего сотрудника, используя их способности и честолюбие. Плеве был прекрасным психологом, с первого взгляда определяя возможности человека, его помыслы и устремления. Не случайно именно Плеве ходатайствовал перед Александром III о прощении Л. Тихомирова. Плеве назначил на ключевой пост начальника Охранного отделения скромного подполковника

Судейкина, сыгравшего большую роль в разгроме террористов. Подчиненные Плеве с восхищением говорили, что на допросах путем умелой беседы, без пыток и рукоприкладства, он «раскалывал» самых твердых и фанатичных революционеров.

«Убийство Александра II». Картина неизвестного российского художника, вторая половина XIX века

Помимо борьбы с революцией Плеве занимался и обычными полицейскими мероприятиями. В 1881—84 по ряду южных городов прокатилась волна еврейских погромов. Плеве видел в актах насилия против евреев нарушение общественного порядка и беспощадно усмирял виновных. Защита евреев от погромов заняла значительную часть дел Департамента полиции.

«Бунт в деревне» Картина С.В. Иванова.

Так, в 1881 в судах слушались 66 дел о нарушении общественного порядка, из которых 11 дел были об антиправительственных выступлениях, а 50  о покушениях на евреев и их имущество, в 1882 из 40 дел 31 было связано с погромами. Плеве, будучи человеком последовательным, в целом положительно относился к сионизму – движению за воссоединение евреев на исторической родине в Палестине, надеясь, что он сможет отвлечь евреев от участия в революционной деятельности. Уже став министром внутренних дел, несколько раз встречался с лидером сионистского движения Теодором Герцлем и обещал поддержку в пропаганде и организации отъезда на землю обетованную. Фон Плеве говорил о том, что правительство не намерено препятствовать сионистам, когда они занимаются эмиграцией в Палестину. Он обещал Т. Герцлю, что русское правительство окажет поддержку сионистам в их переговорах с турецким султаном и будет содействовать созданию сионистской организации в России. Было также обещано некоторое облегчение положения евреев в России.

В. Е. Маковский. «Вечеринка».

Впрочем, главной заслугой Плеве был все же разгром революционного движения. За победу Плеве был удостоен многих наград. В 1884 он стал сенатором и товарищем (заместителем) министра внутренних дел. Помимо привычных для него полицейских дел Плеве теперь занимался проблемами переселений в Сибирь, вопросами преобразования местного самоуправления, руководил Особым комитетом помощи голодающим. 1 янв. 1894 начался новый этап службы Плеве  он занял должность Государственного секретаря в ранге министра. На этом посту Плеве пробыл 8 лет, занимаясь новыми вопросами. Он участвовал в работе Особого Совещания по вопросам дворянского сословия, стал статс-секретарем по делам Великого Княжества Финляндского, председательствовал или был членом еще ряда важнейших учреждений. На посту Госсекретаря Плеве проявлял те же присущие ему работоспособность, энергию, компетентность. Признанием заслуг Плеве стало то, что именно он делал юбилейный доклад на торжественном заседании Государственного Совета 7 мая 1901, посвященного 100-летию этого высшего учреждения Империи. Именно это заседание в момент выступления Плеве перед Императором

Николаем II изобразил на своей картине И. Е. Репин.

Осужденный. Маковский Владимир Егорович. Государственный Русский музей, Санкт-Петербург.

2 апреля 1902 эсерами был убит министр внутренних дел Д. С. Сипягин, а уже через два дня Плеве был назначен на этот пост. Он возглавил МВД в крайне сложной внутренней обстановке. Экономический кризис 1900—03, вызвавший массовые банкротства и породивший значительную безработицу, крайне ожесточил социальные конфликты в городе. Одновременно голод 1901—03 ухудшил положение крестьян, вызвав аграрные беспорядки. По многим вузам страны прокатились студенческие беспорядки. Только что возникшая партия эсеров развернула террористическую деятельность. Действовать Плеве начал сразу. Весной и летом 1902 многие южные губернии были охвачены крестьянским волнением, а на Полтавщине дело дошло до вооруженных столкновений крестьян с войсками. Плеве немедленно отправился в Полтавскую губ. и быстро усмирил восстание. Однако сам Плеве настоял на вынесении крайне мягких приговоров бунтовщикам. В восстании на Полтавщине участвовало до 150 тыс. чел., под суд было отдано около 1 тыс., осуждено 836 чел., причем большинство получили по несколько месяцев тюрьмы, да и то были вскоре отпущены. Причина этого заключалась в том, что мятежные уезды были уже год охвачены голодом, и Плеве не считал нужным наказывать голодных озлобившихся людей. В «рабочем вопросе» Плеве также стремился, подавляя открытые выступления с помощью полиции, проводить политику сглаживания социальных конфликтов под эгидой Самодержавия. Признавая рабочее движение как реальную силу и считая многие требования рабочих справедливыми, давая прямо марксистскую оценку причинам, вызывающим забастовки, Плеве поощрял создание рабочих организаций, не выдвигающих политических требований.

Крах банка. В. Маковский 1881

В этом деле особенно отличился начальник Особого отдела Департамента полиции С. В. Зубатов, создатель целого ряда рабочих организаций, самая крупная из которых возглавлялась Гапоном. Либеральную земскую оппозицию Плеве усмирил очень простым способом, назначив административные ревизии по проверке деятельности земств. Проверки вскрыли вопиющие злоупотребления, и некоторые губернские земства (Вятское, Московское, Тверское) лишились до половины гласных (депутатов), отданных под суд за коррупцию. Интересно, что наиболее проворовавшиеся земские деятели были одновременно и самыми либеральными, во всяком случае, в своих речах. И наконец, Плеве крепко «держал» в руках большинство революционных организаций, во главе которых стояли осведомители Охранного отделения.

И.Е. Репин «Сходка». 1883 год.

Особенно ценным агентом был один из основателей партии эсеров, руководитель ее боевой организации Е. Азеф. Плеве вполне было по силам нанести поражение революции, подобно тому, что он нанес в 1880-х. Однако два десятилетия спустя обстоятельства приняли иной характер. 15 июля 1904 Плеве погиб в результате взрыва бомбы, брошенной в него эсером Е. Созоновым, на мосту через Обводный канал возле Варшавского вокзала в Петербурге.Во время теракта было ранено 12 посторонних людей, находившихся поблизости. Пострадал и сам террорист. Он потерял сознание и был контужен. Приговором судебной палаты 30 ноября 1904 г. террорист был осуждён к каторжным работам без срока. В силу манифества по случаю рождения наследника, это наказание было сокращено до 14 лет. На каторге Созонов провёл около шести лет. 27 ноября 1910 г. в Зерентуйской каторжной тюрьме он покончил с собой.

РЕПИН Илья Ефимович (1844-1930) «Манифестация 17 октября 1905 года». 1907-1911 гг. Холст, масло. 184 х 323 см.
Государственный Русский музей, Санкт-Петербург.

Вскоре после гибели Плеве началась первая русская революция. Параллельно с ростом революционного движения активизировались монархические организации. В 1908 году под эгидой «Союза Михаила Архангела» был издан первый выпуск «Книги русской скорби», посвящённый людям, погибшим в борьбе с терроризмом. Этот выпуск открывался статьёй, посвящённой памяти императора Александра II. Во втором выпуске 1908 г. содержится35-страничный очерк о В. К. Плеве. Во всех 14 томах издания «Книги русской скорби» нет статьи, которая занимала бы больший объём, чем о бывшем министре внутренних дел. Одной из главных причин такого подробного описания было стремление наиболее полно раскрыть его взгляды. Подчеркивалась его искренняя убеждённость в божественном происхождении наследственной власти российского государя, в том, что судьба России вверена царю Божественным Промыслом. Он призывал «поработать, прежде всего, над раскрытием духовной стороны русского самодержавия, намеченной в трудах первых славянофилов, ради очищения автократического принципа и от восточных понятий, и от ереси просвещённого абсолютизма, подставляющего под понятие государства понятие о личности самодержца и заменяющего служебную роль автократического режима на благо народа». В. К. Плеве также считал, что «самодержавие совместимо с широким местным самоуправлением и гражданской свободой». Авторы очерка выделили основные направления его государственной деятельности: урегулирование рабочего законодательства, «ограждение рабочих от произвола фабрикантов»; национализация окраин; обеспечение хозяйственной самостоятельности крестьян и переселение их на казённые земли.

В. К. фон Плеве. И. Репин (1902)

«Московские Ведомости» писали: «Это был в полном смысле слова государственный человек. Он, несомненно, представил бы собой крупное явление в любую эпоху нашей истории, а среди современных нам развинченных, надорванных характеров он возвышался истинным гигантом своею ясною мыслью, глубоким умом, железною волей и золотым сердцем». В газете «Русь» отмечалось: «В одном не откажут В. К. Плеве даже непримиримые враги его: он был человек долга, умственной дисциплины и упорного, огромного трудолюбия. То, что он считал незыблемо верным, то и было его решением, и он шёл к поставленной цели, не колеблясь, принимая на себя всю ответственность».

В сборнике «Памяти В. К. Плеве», вышедшем вскоре после его смерти, были приведены многочисленные соболезнования его близким, которые были присланы из более чем ста городов России. Писали председатели сельскохозяйственных обществ, земские начальники, предводители дворянства, губернаторы, друзья и знакомые, знавшие министра внутренних дел по службе и лично, люди самых разных сословий.

Пимоненко Николай Корнилович 1862 — 1912. На ярмарке. 1898. Харьковский художественный музей

Телеграммы жене Плеве направили все члены императорской фамилии. Великий Князь Дмитрий Константинович писал: «Сейчас узнал о постигшем Вас тяжёлом горе. Всей душой негодую, скорблю и молюсь с Вами в столь горестном и постыдном для истинно русских людей событии».

Лучшей характеристикой Вячеслава Константиновича могут служить слова, записанные 15 июля 1904 г., в день его убийства, Государем Николаем II: «В лице доброго Плеве я потерял друга и незаменимого министра вн. д. Строго Господь посещает нас Своим гневом!».

Плеве выступал с резкой критикой готовившейся Витте крестьянской реформы, разработав её собственный план, в котором упор делался на хуторское землевладение. Проект предусматривал внеэкономические меры защиты помещичьего землевладения, включая законодательный запрет на операции Крестьянского банка по скупке помещичьих земель почти на всей территории Европейской России.

Дети в санях. Художник БОГДАНОВ-БЕЛЬСКИЙ Николай Петрович

«При Плеве директором Департамента полиции был А.А. Лопухин, самый молодой из сановников, бывший прокурор судебной палаты, человек выдающихся способностей и огромной памяти. Невольно приходит на ум вопрос, могли Плеве, избравший себе в сотрудники Лопухина и Урусова, быть организатором погромов? А между тем вся революционная пресса, как в России, так и за границей, сделала из него «погромщика». Тщательный просмотр при Временном правительстве всех секретных документов Департамента полиции, Министерства внутренних дел и охранных отделений не дал ни одной бумаги, которая могла бы компрометировать старую власть в этом отношении. Наоборот, там были найдены указания на строгие кары, отрешения от должностей и даже увольнения за всякое незаконное действие исполнительных агентов в еврейском вопросе».( П.П.Заварзин.)

«По воспоминаниям графа С. Ю. Витте, бывшего политическим соперником Плеве, Плеве якобы говорил о русско-японской войне: «Нам нужна маленькая победоносная война, чтобы удержать Россию от революции». Впервые эта приписываемая Плеве фраза была опубликована в книге «Исход российской революции 1905 года и правительство Носаря», вышедшей под псевдонимом А. Морской (псевдоним В. И. фон Штейна), содержавшей критику Плеве и рекламу Витте. Современники считали эту книгу инспирированной или даже написанной самим Витте. Затем та же фраза появилась в посмертно изданных воспоминаниях графа Витте».(Википедия)

Ист. изображения: С.И. Голотик, С.В. Карпенко, Т.Ю. Красовицкая, В.В. Минаев. РОССИЯ НА РУБЕЖЕ XIX – XX вв. ВЛАСТЬ, ЭКОНОМИКА И ОБЩЕСТВО. ЖУРНАЛ РОССИЙСКОГО ГОСУДАРСТВЕННОГО ГУМАНИТАРНОГО УНИВЕРСИТЕТА

Погром в Киеве. 19 век. Гравюра

Орлов А.С., Георгиева Н.Г., Георгиев В.А. Исторический словарь. 2-е изд. М., 2012, с. 396.
Шикман А.П. Деятели отечественной истории. Биографический справочник. Москва, 1997 г.
П.П.Заварзин. Моя служба в Отдельном корпусе жандармов. В кн.: «Охранка». Воспоминания руководителей политического сыска. Тома 1, М., Новое литературное обозрение, 2004. с. 441-442.
Лебедев С.В. Происходил из семьи обрусевших православных немцев (Большая энциклопедия русского народа)

Россия на рубеже веков люди и события в рамках 1125-летия Российской государственности

Общие цели:

  • Обобщить знания учащихся об определённой роли государства в экономической жизни страны;
  • О влиянии отечественного и иностранного капитала на развитии экономики;
  • Выделить особенности российского монополистического капитализма;
  • Акцентировать внимание на нарастание экономических и социальных противоречий в условиях форсированной модернизации;
  • Провести анализ реформ П. Столыпина. охарактеризовать политику успокоения.

Дополнительные цели:

  • показать роль личности в истории на дальнейшее развитие России, высказать своё отношение к тезису о глубокой отсталости и полуколониальной зависимости России от экономически развитых держав;
  • установить причинно-следственные связи между реформаторским курсом С.Ю.Витте и успехами промышленного развития Российской империи;
  • сравнить две точки учения на дальнейшее развитие России С.Витте, В.Плеве, определить общее;
  • выразить своё отношение к идеям С.Витте, В.Плеве;
  • оценить основные положения “Манифеста 17 октября”;
  • установить причинно следственные связи противоречивости политики П. Столыпина;
  • продолжать работу по формированию умения вести дискуссию.

Основные понятия: модернизация, протекционизм, синдикаты, картели, “догоняющий империализм”, “полицейский” (зубатовский) социализм” третьиюньская монархия, отруб, хутор, переселенческая политика.

Исторические персоналии: С.Ю.Витте, В.К.Плеве, Е.В.Зубатов, Г.Гапон, П.А.Столыпин, Николай II.

Оборудование:

  • Карты:
  • Российская империя в конце XIX – начале XX в;
  • Первая русская революция 1905-1907 г.г.
  • Столыпинская аграрная реформа 1906-1911 г.г.
  • Мультимедийный компьютер.
  • Мультимедийный проектор.
  • Экран проекционный.

Раздаточный материал.

  • Методическое пособие Н.В.Загладин “История России”, издат-во “Учитель”, 2013 г
  • В.Ю.Захаров “Трудные вопросы на экзамене История России”, М. “Дрофа”, 2009 г.

Форма проведения: Семинар (2 часа)

План урока:

  1. Организационный момент.
  2. Работа с планом семинара
    1. Презентация С.Витте, В.Плеве (учащиеся)
      1. Сравнить точки зрения С. Ю.Витте и В.К.Плеве на дальнейшее развитие России.
    2. Презентация С.В.Зубатов; Г.А.Гапон, (учащиеся).
      1. Что связывало эти две личности и какую роль они сыграли в Первой русской революции.
    3. Презентация – П.А.Столыпин (учащиеся).
      1. Реформы П.Столыпина: Путь к успокоению страны.
    4. Презентация – Николай II (кровавый) (учащиеся).
  3. Подведение итогов семинара.

Ход урока

1. Оргмомент. Вводное слово учителя: исторический путь России всегда был своеобразен и отличался как от западного, так и восточного цивилизационного развития и большую роль, в нём играли исторические личности. Сегодня мы ещё раз убедимся в этом.

2. Обсуждение проблемы. Сравнить точки зрения С.Витте и В. Плеве на дальнейшее развитие России.

Работа с планом семинара.

1. Просмотр перезентации: “С. Витте, В. Плеве — политические и государственные деятелиРоссии (3-5 мин). (Приложение №1)

2. Обсуждение проблемы. Сравнить точки зрения С. Витте и В. Плеве на дальнейшее развитие России.

План обсуждения:

а) Российская модель экономической модернизации (в процессе обсуждения учащиеся используют материалы учебника, автор Загладин Н. В., раздаточный материал – таблицы, материал презентации). В ходе обсуждения должны прийти к выводу – Витте – сторонник ускоренной индустриализации, создание собственной промышленности, запущенной от иностранной конкуренции, привлечение иностранного капитала, вмешательство государства в управление экономикой, отстаивание интересов дворянства, ограничение свободы предпринимательства; Плеве – консервативные взгляды: Россия должна развиваться не по общемировым законам, а собственным оригинальным путём. Будущее России – за дворянством и страну минует гнёт капитализма. Выступая за сохранение общины и сословности.

б) в рабочем вопросе:

С.Витте “Государство не должно вмешиваться в отношения между трудом и капиталом. Его компетенция – принятие законов, и споры должны решаться между предпринимателями и рабочими на их основе”.

В.Плеве: придерживался традиционно- попечительской политики по отношению к рабочим, в виде экспериментов, допуская заимствования из западных стран, пример – полицейский (зубатовский социализм).

Вывод:

В стране проводился прежний курс, что в дальнейшем привело к революции.

Ресурсный материал для групп.

С.Витте Николаю II: “Там где плохо овцам, плохо и овцеводам”

Английский публицист Э.Дилкон рисовал западным читателям портрет “самого мужественного политического деятеля в Европе: человека грубого, неповоротливого, угловатого, медленного в речи, но быстрого в действиях. Под суровыми чертами которого скрыты жесты прометеева огня, исполняющего “геркулесову работу” и не имеющего себе равных во всём пространстве Российской империи” (портрет С. Витте).

3. Просмотр презентации: С.Зубатов, Г.Гапон (3-5 мин.), (Приложение № 2).

4. Обсуждение проблемы “Что связывало эти два имени и какую роль они играли в первой русской революции.

Мотивация к обсуждению:

Cтихи об исторических событиях 1905 г. “Литературный Петербург”

“Бежали, пальцами закрывши лица,
И через них струилась кровь.
Шумела в колокол столица,
На то, что было, будет вновь,
Чугунных певчих, без имён –
Придворных пушек рты открыты;
Это отец подымал свой ремень
На тех, кто не сыты!”
В.Хлебников.

Ресурсный материал для групп (читает учитель на этапах обсуждения).

А.М.Деникин “....Война не могла быть популярна в русском обществе и в народе,,,, Армия пошла на войну без всякого подъёма, исполняя только свой долг” (причины революции).

Разговор между А.М.Горьким и С.Т.Морозовым – 9 января 1905 года: “Революция обеспечена. – сказал Савва. – Годы пропаганды не дали бы того, что достигнуто в один день. – Жалко людей. – проговорил А.Горький. – Ах, вот что. – Морозов вскочил и забегал по комнате. – Конечно – однако – это другое дело. Тогда же надо говорить им: вставайте. Тогда убеждайте их – пусть они терпеливо лежат и гниют... Позволив убивать себя сегодня люди приобрели право убивать завтра. Они конечно. Воспользуются этим правом. Я не знаю, когда жизнь перестанут строить на крови, но в наших условиях гумманность - ложь” (вопрос. Похоже С.Морозов прав, и всё же... Может ли гуманность быть ложью).

А.Ф.Трепов “Патронов не жалеть и холостых залпов не давать!”

В процессе обсуждения учащиеся должны красной линией провести мысль о роли С.Зубатова и Г.Гапона в первой русской революции, вскрывая: - причины. Повод и результаты – принятие Манифеста 17 октября положительные и отрицательные стороны роли личности в истории, замедляющие или ускоряющие исторический процесс (В обсуждение включить вопрос “Знал ли Георгий Гапон о расстреле мирного шествия?).

Вывод. С.Витте, Николаю II: “...есть только два способа превозмочь смуту – либо путём диктатуры, либо превращение России в Конституционное правовое государство”.

5. Просмотр презентации – П.А.Столыпин (3-5 мин.) (Приложение № 3).

6. Обсуждение проблемы: “Реформы П.Столыпина – путь к успокоению страны”.

Ресурсный материал для групп:

  • В.В.Шульгин “Всё для народа – вопреки народу” (лозунг аграрной реформы).
  • П.Столыпин: “Разрешить этот вопрос нельзя, его надо развешать”.
  • П.Столыпин “...Пробыв около десяти лет у дела земельного устройства. Я пришёл к глубокому убеждению, что в деле этом нужен упорный труд, нужна продолжительная чёрная работа... В западных государствах на это потребовались целые десятилетия...”. (стр. 55–56 методического пособия).

“Вешатель”, “реакционер”, “либеральный консерватор” - различные, порой взаимоисключающие характеристики в зависимости от занимаемых теми ил иными людьми позиций давались одному из наиболее ярких государственных деятелей России первого десятилетия ХХ в, премьер-министру П.А.Столыпину (оценка политических взглядов и деятельности П.А.Столыпина).

В ходе обсуждения раскрываются:

“Цели, основные мероприятия, итоги реформ”.

7. Подводит итог семинарскому занятию презентация “Николай II (кровавый)” (Приложение 4), в которой раскрывается путь пройденный Россией и роль императора в исторических событиях конца XIX - начала XX в.

8. Подведение итогов.

Oценки, комментарии, замечания, положительные моменты.

Домашнее задание.

Повторить параграфы 1–7, подготовиться к контрольной работе.

Сходства и различия в политико-реформаторской деятельности С.Ю. Витте и П.А. Столыпина.

Автор исследования Попова Наталья.

Сходства:
1) По политическим взглядам были убежденными монархистами, считали самодержавие лучшей формой правления для России, но были готовы пойти на некоторые уступки демократии ради сохранения самодержавия. При этом оба политика подвергались яростной критике, как справа, так и слева.
2) Как Витте, так и Столыпин были крайне негативно настроены против революции. Другой вопрос, что Столыпин шёл ради «успокоения» на более радикальные меры, чем Витте. В частности, к таковым относятся введение военного положения в ряде губерний, введение военно-полевых судов. Сергей Юльевич предпочитал более деликатные меры по нормализации обстановки в обществе. В частности, к таковым относится Манифест 17 октября          1905 года.
3) Так же как Витте, Столыпин многие из своих реформ проводил вразрез с общепринятым порядком. Если Сергею Юльевичу в этом помогал симпатизирующий ему император Александр III, то Петр Аркадьевич нередко пользовался 87 статьей Основных государственных законов.
4) В экономических вопросах С.Ю. Витте и П.А. Столыпин многие идеи унаследовали от своих предшественников: Витте — из наработок Н.Х. Бунге,  а Столыпин — из наработок Витте, Святополк-Мирского, Вышнеградского. Они были солидарны в крестьянском вопросе, безусловно сходились во мнениях относительно того, что крестьянская община-пережиток крепостнической России, а развитие страны без аграрной реформы , создания частной крестьянской собственности на землю      - невозможно. Столыпин: «Нельзя любить чужое наравне со своим и нельзя обхаживать, улучшать землю, находящуюся во временном пользовании, наравне со своею землей».
5) Витте и Столыпин занимали схожую позицию касательно государственных займов. Они единогласно были за политику постепенного отказа от них. Если быть совершенно точным, то Столыпин был за немедленный отказ от новых крупных займов при постепенном возвращении старых и получении незначительных новых. Витте высказывался за продолжение получения кредитов, однако, при реструктуризации внешнего долга и обширных закупках золота за счет полученных средств в целях увеличения золотовалютного резерва.
 6) У Витте и у Столыпина были схожие позиции относительно железнодорожного строительства. При Витте в стране начался железнодорожный бум, что касается я Столыпина, то он ни в коем случае не умалял роли железных дорог в развитие страны. При Столыпине продолжалось строительство Транссиба.
     Таким образом: в главной цели оба политика совпадали: осуществить модернизацию страны, добиться успешного развития экономики России, не затрагивая принципиальных основ политической системы, ничего не меняя в государственном управлении.

Различия:

1) В основе большинства реформ Витте было создание промышленной базы и финансовое оздоровление, Столыпин — делал упор на реформирование аграрного сектора, создание «фермерского класса» и реформу государственного управления. Но, возможно каждый решал наиболее актуальные для своего времени задачи.

2) Еще одно существенное различие в реформаторской деятельности Витте и Столыпина заключается в том, что Сергей Юльевич заявлял о своей готовности в течение короткого срока вывести Россию в разряд передовых промышленных держав, а Петр Аркадьевич считал, что изменения должны проводиться последовательно.

3) И Витте, и Столыпин занимались укреплением финансовой стороны, но если у Сергея Юльевича эта стадия была начальной, то для Петра Аркадьевича она являлась последним в его жизни проектом. В обеих программах большая роль отводилась иностранным капиталам. Витте выступал за их неограниченное привлечение в русскую промышленность и железнодорожное дело, тогда как Столыпин считал, что использование иностранных займов надобно только в строительстве железных дорог (особенно с твердым покрытием) и на исследование недр земли.

4) В попытке решения национального вопроса Столыпин проявил себя более ярко. Факт остается фактом: Витте не поднимал еврейский вопрос или какой-либо другой, связанный с ущемлением прав тех или иных народов на территории России в отличии от Столыпина.

5) Столыпин был ярым противником внешних войн, если неокончательно убежденным пацифистом. Мы не можем сказать относительно Витте, что он был настолько против войны, но общеизвестны его усилия, как миротворца в случае с  Портсмутским мирным договором, о котором он говорил, что: «Я спас самодержавие и Россию от краха».

       Итак, несмотря на очевидное сходство целей и содержания реформ Витте и Столыпина, мы выявили ряд существенных отличий в методах и средствах. Это объясняется следующими обстоятельствами: во-первых, хотя их реформаторскую деятельность разделяло несколько лет, за эти года в России многое переменилось. Нерешенность ключевых проблем накопилась и привела к революции. Именно поэтому, когда недовольство достигло своего пика, к Столыпину прислушались, как к единственному человеку, способному найти решение проблемы. Витте же не имел такого шанса, так как в то время власть была спокойна за свое положение в обществе.

      Источники информации:

ñ   http://ru.wikipedia.org/wiki/%D0%9E%D1%82%D0%BD%D0%BE%D1%88%D0%B5%D0%BD%D0%B8%D1%8F_%D0%A1%D1%82%D0%BE%D0%BB%D1%8B%D0%BF%D0%B8%D0%BD%D0%B0_%D1%81_%D0%92%D0%B8%D1%82%D1%82%D0%B5

ñ   Горкин А.П. Большой энциклопедический словарь школьника.

ñ   Пушкарев С.Г. Обзор русской истории.


Витте Сергей, история жизни, значимые события и заслуги

Он стремительно взошел на политический олимп. С его именем связаны крупнейшие преобразования в России: индустриальная модернизация, денежная реформа 1895-1897 гг., а также Портсмутский мир и Манифест 17 октября 1905 г. С.Ю. Витте много полезного сделал для развития отечественной экономики, реформирования политической системы, в сфере внешней политики. Перед потомками предстает государственный деятель нового типа: это не только энергичный и убежденный реформатор, но и талантливый практик, все достоинства которого соответствовали потребностям переживаемой эпохи.

Глава Министерства путей сообщения, министр финансов, председатель Комитета министров, первый глава Совета министров, член Государственного совета — таковы основные служебные посты, на которых проходила его деятельность. Этот известнейший сановник оказал заметное, а во многих случаях и определяющее, влияние на различные направления внешней, но особенно внутренней политики империи, став своеобразным символом государственной системы. Значение и масштабы его исторической роли сравнимы только с личностью другого выдающегося администратора-преобразователя периода заката монархии — Петра Аркадьевича Столыпина.

Родился С. Ю. Витте 17 июня 1849 г. в Тифлисе в небогатой дворянской семье. Сдав экстерном экзамен за гимназический курс, он поступил на физико-математический факультет Новороссийского университета. В 1869 г. начал службу в канцелярии одесского генерал-губернатора, где занимался учетом железнодорожного движения, а через год был назначен начальником службы движения казенной Одесской железной дороги.

В 1879 г. работал в Петербурге, в качестве начальника отделения эксплуатации в правлении Юго-Западных железных дорог. После трагедии у станции Борки, где пострадали члены императорской семьи в 1888 г., Витте по инициативе Александра III был назначен директором департамента железнодорожных дел и председателем тарифного комитета, а в 1892 г. стал управляющим министерством путей сообщения.

В конце того же года Витте был назначен на пост министра финансов, который он занимал 11 лет. Витте сделал важный шаг в укреплении позиций российского рубля в мире, осуществив в 1897 г. переход к золотому обращению.

Он понимал, что накопление средств в бюджете государства шло недостаточными темпами для развития промышленности и ускорения темпов индустриализации. Именно поэтому, в 1896 г. Витте выступил с идеей винной монополии государства, которая, однако, реально была введена только в период 1906-1917 гг.

В 1903 г. Витте, заняв пост председателя комитета министров, фактически оказался отстраненным от дел из-за придворных интриг. Пост председателя комитета министров до революции 1905 г. был скорее почетной ссылкой, нежели возможностью для Витте проявить себя в качестве государственного деятеля.

Николай II, находясь под влиянием правых придворных группировок, отправил Витте в г. Портсмут для подписания мирного договора с Японией. Отправка Витте — это еще один способ подорвать его репутацию. Стоит отметить, что полный провал военной кампании русской армии во время войны, гарантировал японской дипломатии карт-бланш на предъявление России территориальных требований. В частности Япония требовала передать ей весь о. Сахалин. Витте удалось в половину уменьшить размер территориальных потерь. За это достижение, а также за долгую службу государству Николай II пожаловал Вите титул графа, а придворная клика добавила приставку «Полу-Сахалинский».

С началом первой русской революции в 1905 г. Витте получил возможность стать председателем Совета министров Российской империи, но как только власть начала реализовывать реакционные меры, Витте отошел от дел. Последняя опала Витте длилась вплоть до его смерти.

Практикум по истории России в 11 классе. Начало XX века.

Практикум

по истории России

11 класс

«Россия в первой половине XX века».

Автор: Баскакова Л.Л.

Пояснительная записка.

Практические проверочные работы, предложенные в данном учебном пособии, составлены в соответствии с требованиями Федерального Стандарта образования средней школы, основаны на содержании учебника «История России. XX - начало XXI века. 11 класс» А.А. Левандовского, Ю.А. Щетинова. Целью работ является построение системы мониторинга, позволяющей проследить динамику учебных достижений, как каждого учащегося, так и класса в целом. Для учителя это пособие позволит систематически контролировать полученные знания учащихся. Для учащихся – возможность подготовиться к итоговой аттестации выпускников.

В пособии предлагаются контрольные работы по каждой изучаемой теме, независимо какая программа обучения учителем реализуется.

Пособие может быть использовано в общеобразовательных школах, гимназиях, лицеях, средних специальных учебных заведениях. Оно может помочь учащимся осуществлять самостоятельную подготовку по истории России. Использование пособия сократит время учителя на составление контрольных заданий, а также позволит получить информацию о пробелах в знаниях учащихся.

Контрольные работы включают несколько основных содержательных моментов:

Проверка знания дат и ключевых событий истории первой половины XX века.

Проверка знаний исторической терминологии.

Проверка умений находить причинно-следственные связи исторических событий, позволяющие делать выводы.

Проверка умений анализировать, давать оценку историческим событиям и явлениям.

Задания со «звездочкой» подготовлены для тех, кто хочет полнее знать историю России.

Петербург в начале XX века.

Сенная площадь вначалеXXвека, Успенская церковь, корпуса Сенного рынка.

ТЕМА: РОССИЙСКАЯ ИМПЕРИЯ.

Тема №1.

Российская империя на рубеже веков.

1. Основными проблемами развития России в началеXX века стали:

____________________________________________________________________________________

2.Назови социальный состав населения России в начале XX века. ____________________________

_____________________________________________________________________________________

3.Какова численность населения была в начале XX века в России?

а) 129 млн., б) 138 млн., в) 125 млн., г) 126 млн.?

4. Большая численность крестьян свидетельствовала о ____________________________________________________________________________________

____________________________________________________________________________________

5. Рост численности рабочих зависел от: ____________________________________________________________________________________

6. Процесс, связанный с ростом доли городского населения называется ____________________________________________________________________________________

7. Процесс, связанный с бурным развитием промышленности, называется ____________________________________________________________________________________

8. «Даже военный потенциал страны определяется… степенью ее промышленного развития. Россия нуждается, возможно, более, чем какая-либо другая страна, в надлежащей экономической основе для ее национальной политики и культуры». О чем говорил С.Ю. Витте Николаю II. ____________________________________________________________________________________

9. Многоконфессиональность России представлена ____________________________________________________________________________________

10. Многонациональность – это ________________________________________________________

____________________________________________________________________________________

11. Сформулируй основные выводы о развитии Российской империи на рубеже веков_______________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

Тема № 2.

Экономическое развитие России.

1. Особенностью Российской экономики являлась ее _______________________________________

2. В каком году в России была проведена финансовая реформа, в результате которой рубль получил золотое обеспечение?

а) в 1894 г.; б) в 1897 г.; в) в 1903 г.

3. Монополистическое объединение предприятий, формально сохраняющих самостоятельность, но фактически подчиненных централизованному финансовому контролю и руководству ____________________________________________________________________________________

4. Капитал, образовавшийся в результате сращивания банков и предприятий называется ____________________________________________________________________________________

5. На какой товар по предложению С.Ю.Витте в конце XIX века была введена государственная монополия, дававшая казне самые высокие доходы?

а) соль; б) зерно; в) вино и водка.

6. Какие заводы входили в государственный сектор экономики России в начале XX века?

а) металлургические; б) текстильные, в) военные.

7. Какой процент в российской экономике в начале XX века составляли иностранные инвестиции?

а) 5% всех капиталовложений; б) 90%; в) 40%.

8. Какое европейское государство направляло инвестиции в российскую нефтяную промышленность в начале XX века?

а) Англия; б) Германия; в) Италия.

9. Какие монополистические союзы и объединения преимущественно создавались в конце XIX – начале XX веков?

а) тресты; б) концерны; в) синдикаты.

10.Основной проблемой российской экономики является ___________________________________

11. Участие государства в российском капитализме определило его ________________________ характер.

12.Самыми крупными монополистическими объединениями были ____________________________________________________________________________________

13. Сращивание банковского и промышленного капитала образовало ____________________________________________________________________________________

14. Назовите причины экономического кризиса начала XX века______________________________

___________________________________________________________________________________________________________________________________________________________________________

____________________________________________________________________________________

15. Чем характеризовался промышленный подъем начала XX века?___________________________

____________________________________________________________________________________
16. Назови причины высокого уровня промышленного прироста в пореформенной России (1861-1913)_______________________________________________________________________________

17. Каковы были темпы развития в сравнении с ведущими странами мира? ___________________

____________________________________________________________________________________

18. Какие отрасли промышленности развивались наиболее активно?__________________________

____________________________________________________________________________________

Тема №3

Социально-экономическое положение России.

1. Самым многочисленным сословием было сословие:

А) рабочих, б) помещиков, в) буржуазии, г) крестьянства, в) духовенства.

2. С.Ю.Витте в 1895 г. заявил: «К счастью, в России не существует, в отличие от Западной Европы ни рабочего класса, ни рабочего вопроса».

Подтвердите или опровергните его слова. Чем можно объяснить появление такого утверждения._________________________________________________________________________

______________________________________________________________________________________

Витте Сергей Юльевич

3. В 1903 г. В.К. Плеве признался французскому послу в России Бомпару: «Меня выдвинули на этот пост как человека крепкой руки. Если я проявлю малодушие в проведении репрессий, смысла в моей деятельности не будет. Раз уж я начал, надо продолжать. Я сижу на пороховой бочке и взорвусь вместе с ней». О какой политике и идеологии идет речь?

____________________________________________________________________________________

Плеве Вячеслав Константинович

4. Высказывание С.Ю.Витте, разрабатывавшего в 1903-1904 г.г. основные положения крестьянской реформы: «Общинное владение есть стадия только известного момента жития народов; с развитием культуры и государственности оно неизбежно должно переходить в индивидуализм – в индивидуальную собственность; если же этот процесс задерживается и в особенности искусственно, как это было у нас, то народ и государство хиреют». Как С.Ю.Витте относился к русской общине? Почему он связывал процветание народа и государства с переходом к индивидуальной собственности?___________________________________________________

5. После отмены крепостного права экономические отношения между крестьянами и помещиками регулировались с помощью _________________________________________________________­­­­­___

6. Самыми немногочисленными социальными группами были: ______________________________

____________________________________________________________________________________

7. Главным привилегированным сословием являлось сословие_________________________________

8. Появление сельской буржуазии и сельской наемной рабочей силы свидетельствовало о процессе ______________________________________________________________________________________

9. Какие особенности были присущи российской интеллигенции начала XX века?_______________________________________________________________________________________________________________________________________________________________________

10. Перечислите накопившиеся острые социальные проблемы:

в среде рабочих и крестьян: ____________________________________________________________

в среде помещиков и буржуазии _________________________________________________________

11.Сословный строй соответствует:

а) эпохе рабовладения; б) эпохе феодализма; в) эпохе капитализма; г) эпохе рабовладения и феодализма; д) верно все сказанное.

Тема №4.

Внутриполитическое развитие страны.

1. В каком году Николай II взошел на престол?

а) в 1894 г., б) в 1896 г., в) в 1898 г.

2.«Его политика всегда сводилась к тому, чтобы в крайних случаях идти на минимальные уступки обществу, а данные торжественные обещания не выполнить, если окажется малейшая к тому возможность» (Головин Ф.А.) О ком идет речь?____________________________________________

3.Кто был министрам внутренних дел России в начале XX века?

а) В.К. Плеве; б) С.Ю.Витте; в) П.Д.Святополк – Мирский.

4. Министром финансов России в начале XX века был:

а) В.К. Плеве; б) С.Ю.Витте; в) П.Д.Святополк – Мирский .

5. Положение 14 августа 1881 года о мерах к охранению государственного порядка и общественной безопасности регламентировало губернаторам, генерал-губернаторам, градоначальникам по подозрению в неблагонадежности:

А) ссылать сроком на 5 лет без суда и следствия;

Б) запрещать любые общественные собрания;

В) вмешиваться в деятельность земских и городских общественных органов;

Г) увольнять недовольных служащих городских и общественных органов;

Д) закрывать торговые заведения;

Е) закрывать промышленные предприятия;

Ж) закрывать учебные заведения

С какой целью и по какой причине НиколайII использовал это Положение?

______________________________________________________________________________________

______________________________________________________________________________________

6. Почему Николай II был прозван в народе «кровавым»?

а) за развязывание русско-японской войны; б) за трагедию, разыгравшуюся на Ходынском поле в Москве во время его коронации; в) за расстрел мирной демонстрации 9 января 1905 г. в г. Санкт-Петербурге.

7. Какой курс внутренней политики осуществлял Николай II? ________________________________

8. 17 января 1895 г. Николай II произнес: « Мне известно, что в последнее время слышались в некоторых собраниях голоса людей, увлекающихся бессмысленными метаниями об участии представителей земств в делах внутреннего управления. Пусть все знают, что я, посвящая все силы народному благу, буду охранять начало самодержавия так же твердо и неуклонно, как охранял его мой незыблемый покойный родитель». Каких реформ ждала от Николая II общественность? ____________________________________________________________________________________________________________________________________________________________________________

9. Главной опорой самодержавия являлось:

А) крестьянство; б) дворянство; в) буржуазия; г) рабочий класс; д) духовенство.

10. Почему долгое время буржуазия не была в оппозиции к самодержавию?

______________________________________________________________________________________

11. Назови причины, которые привели к неоднородным отношениям дворянства и власти

______________________________________________________________________________________

12. Какие взгляды на крестьянский вопрос существовали у В.К. Плеве и С.Ю. Витте

В.К. Плеве

С.Ю. Витте

1.

2.

3.

1.

2.

3.

Чем они отличались?___________________________________________________________________

13. Каких взглядов на решение крестьянского вопроса придерживался Николай II? Чью точку зрения поддерживал? ___________________________________________________________________

14. В чем заключалась двойственность внутренней политики Николая II? ______________________________________________________________________________________

15. Начальником Московского охранного отделения в начале XX века был ______________________________________________________________________________________

16. С какой целью были созданы Общества взаимного вспомоществования рабочих на промышленных предприятиях Москвы в начале XX века ?

А) для решения политических вопросов;

Б) для решения экономических вопросов;

В) для решения социальных вопросов.

17. С какой целью была создана Независимая еврейская рабочая партия? Найти лишнее.

А) с целью решения национального вопроса;

Б) с целью решения рабочего вопроса;

В) с целью отказа еврейского населения от политической и революционной борьбы;

Г) с целью решения политических вопросов.

18. Почему потерпела крах политика «зубатовщины»? Как это отразилось на рабочем движении? ____________________________________________________________________________________________________________________________________________________________________________

Тема №5.

Внешняя политика России.

Назови причины активной внешней политики России на Дальнем Востоке в началеXX века:

______________________________________________________________________________________________________________________________________________________________________

Какое европейское государство становилось наиболее опасным противником России в началеXX века?

А) Англия; б) Франция; в) Германия; Г) Австро-Венгрия.

КВЖД – это _____________________________________________________________________

Соглашение России с каким государством называется «сердечным»?

а) с Англией; б) с Францией; в) с Германией; г) с Японией.

С какой целью было создано общество, называемое «безобразовской кликой»?

________________________________________________________________________________

Назови причины русско-японской войны:

________________________________________________________________________________
________________________________________________________________________________

Русско-японская война произошла:

а) в 1904-1906 гг.; б) в 1905-1906 гг.; в) в 1904-1905 гг.; г) в 1905-1907 гг.

27 января 1904 г. два русских корабля были атакованы японской эскадрой в корейском порту Чемульпо. Это корабли:

а) «Пушкин» и «Александр 1»; б) «Варяг» и «Кореец»; в) «Россия» и «Продуголь»; г) «Морозов» и «Макаров».

Порт-Артур - это некогда существовавшая исправительная колония.

Душой героической обороны Порт - Артура был генерал:

а) Ф.Ф.Ушаков; б) П.Н. Врангель; в) Р.И. Кондратенко; г) А.Н. Куропаткин д) А.М. Стессель.

В августе 1904 г. русские войска проиграли сражение:

а) под Ляояном; б) на реке Шахе; в) под Мукденом; г) у о.Цусима.

Морское сражение в районе острова Цусима произошло в :

а) апреле 1905 г. б) мае 1905 г. в) июне 1905 г.; г) июле 1905 г.; д) мае 1904 г.

Переговоры о заключении мира с Японией вел в Портсмуте:

а) П.А. Столыпин; б) С.Ю. Витте; в) П.Д. Святополк- -Мирский; г) Р.И. Кондратенко.

13. Посредником в заключении мирного договора между Россией и Японией

являлось государство:

А) Германия; б) Франция; в) Китай; г) США.

Кто из государственных деятелей России носил прозвище граф Полусахалинский:

а) С.Ю. Витте; б) А.Н. Куропаткин; в) Е.И. Алексеев; г) П.Д. Святополк-Мирский.

Заполните таблицу:

Вопросы для сравнения

Россия

Япония

Цели и планы сторон

Характер войны

Итог войны

16. По мнению С.Ю. Витте, «несчастная война на десятки лет приблизила революцию». Раскройте смысл этого высказывания. Почему война была несчастной? ______________________________________________________________________________________________________________________________________________________________________

Генерал Кондратенко

Тема № 6.

Народные движения и общественная борьба накануне первой русской революции.

Рабочее движение накануне революции характеризовалось: ________________________________________________________________________________

Крестьянское движение накануне революции характеризовалось: _______________________________________________________________________________

Традиции народничества поддерживала партия:

а) эсеров; б) эсдеков; в) кадетов; г) монархистов.

4. Революционные силы были представлены партиями: __________________________________

5. Из секретного письма Николаю II представителей одной из российских партий началаXX века: «Светлое будущее России не в грязи европейского парламентаризма, а в русском самодержавии, опирающемся на народные массы и на совет выборных деловых людей, а не интриганов. Русская буржуазия, не имея свежести самобытной, заразилась гнилью Запада». Предположите, какую организацию представляли эти авторы?______________________________________________________________________________

6. Развитие социализма через общину, социализация земли, уничтожение частной собственности на землю, уравнительное распределение земли через общину – программные установки партии ______________________________________________________________________

7. «Союз борьбы за освобождение рабочего класса» стал основой создания партии ______________________________________________________________________________________

8. Идейной основой социал-демократической партии стало учение:

А) К. Маркса; б) В. Ленина; в) В. Чернова; г) П. Милюкова

9. РСДПР – это____________________________________________________________________

10. II съезд РСДРП состоялся в:

А) 1902 г, б) 1904 г.; в) 1905 г.; г) 1903 г.

11. Перечисли основные положения программы – минимум:

_________________________________________________________________________________

_________________________________________________________________________________

Перечислите основные положения программы – максимум:

______________________________________________________________________________________________________________________________________________________________________

Найдите общее и отличное в программных установках эсеров и эсдеков:

Общее

Социал - революционеры

Социал- демократы

Отличное

Социал - революционеры

Социал- демократы

Индивидуальный террор – один из методов революционной борьбы _______________партии.

Сторонников В. Ленина, участвовавшие в выборах Центрального Комитета называли ____________________________________________________________________________.

Главным оппонентом В. Ленина в организации работы партии социал-демократов являлся:

А) П. Милюков; б) В. Чернов; в) Ю. Мартов; г) Г. Плеханов.

18. Соотнеси:

1) введение конституции а)«легальные марксисты»

2) победа общинного социализма мирным путем б) конституционалисты

3) распад старых отношений, утверждение капитализма в) либеральные народники

без революционных методов

19. Вычеркни лишнее.

В 1904 г. в Петербурге на съезде либералов был образован «Союз освобождения», провозгласивший:

А) отчуждение путем выкупа части помещичьих земель;

Б) свержение самодержавия;

В) оказание финансовой помощи крестьянству;

Г) созыв Учредительного собрания и провозглашение Конституции;

Д) установление 8-часового рабочего дня;

Е) ликвидацию отрезков.

20.Что из нижеперечисленного является особенностью становления первой российской многопартийности? (возможно несколько вариантов):

а) более раннее, нежели в европейских странах, появление политических партий;

б) первоначальное оформление социалистических партий;

в) возникновение политических партий исключительно усилиями интеллигенции;

г) небольшое количество политических партий;

д) функционирование в основном легальных, парламентских партий;

е) значительное число политических партий.

21.*Приведите в соответствие таблицу:

Название партии

Требования по национально-государственному устройству

1

Союз русского народа

Право наций на самоопределение. Федеративное устройство государства.

2

Союз 17 октября

Право наций и народностей на культурное самоопределение. Автономия для Польши и Финляндии.

3

Конституционно-демократическая партия

Неделимость России. Автономия Финляндии при условии сохранения тесных связей с империей.

4

РСДРП

Единая и неделимая Россия. Россия для русских.

5

ПРС

Право безусловного самоопределения всех наций и народностей, входящих в состав Российской империи.

Тема №7

Революция 1905-1907 гг.

Перечисли причины революции:

________________________________________________________________________________________________________________________________________________________________

Как называлась зубатовская организация рабочих, которую возглавлял священник Г. Гапон.:

а) «Освобождение труда»; б) «Союз борьбы за освобождение рабочего класса»; в) «Собрание русских фабрично-заводских рабочих Санкт-Петербурга».

3. Чем характеризуется рабочее движение начала XX века?

____________________________________________________________________________________

Что стало поводом революции? _____________________________________________________

________________________________________________________________________________

5. Отметьте в петиции рабочих Николаю II требования, которые были удовлетворены правительством в ходе первой русской революции:

а) введение народного представительства;

б) введение демократических прав и свобод;

в) введение всеобщего обязательного бесплатного образования;

г) отделение церкви от государства;

д) отмена выкупных платежей;

е) 8-часовой рабочий день.

6.Приведите в соответствие даты и события 1905 г.

Вооруженное восстание в Москве; а) апрель-август 1905 г.

Кровавое воскресенье; б) ноябрь 1905 г.

Восстание на броненосце «Князь Потемкин Таврический»; в) 9 января 1905 г.

Всероссийская октябрьская политическая стачка; г) июнь 1905 г.

Севастопольское восстание под руководством лейтенанта

П. Шмидта; д) декабрь 1905 г.

Стачка текстильщиков в Иваново-Вознесенске; е) октябрь 1905 г.

Закончи предложение:

Первые Советы в России были созданы ______________________________________________

Советы – это __________________________________________________________________

________________________________________________________________________________

Советы сыграли большую роль в ___________________________________________________

________________________________________________________________________________

Дайте определение понятиям:

Монархия _______________________________________________________________________

________________________________________________________________________________

Республика______________________________________________________________________

________________________________________________________________________________

Революция_______________________________________________________________________

________________________________________________________________________________

Прочитайте документы и дайте письменные ответы на вопросы.

Из доклада С.Ю.Витте Николаю II 18 марта 1905 г.

Волнение, охватившее разнообразные слои общества, не может быть рассматриваемо, как следствие частичных несовершенств государственного и социального устроения, или только как результат организованных действий крайних партий. Корни этих волнений, несомненно, лежат глубже… Россия переросла форму существующего строя. Она стремится к строю правовому, на основе гражданской свободы.

Из воспоминаний начальника канцелярии Министерства императорского двора А.А.Мосолова.

б. Граф (Фредерикс В.Б. – министр императорского двора) мне рассказал, что когда он, обрадованный приездом Николая Николаевича (Великий князь, дядя Николая II), сказал ему, что его приезд ждали, чтобы назначить диктатором, великий князь, будучи в каком-то неестественном возбуждении, выхватил револьвер и закричал: «Если государь не примет программы Витте и захочет назначить меня диктатором, я застрелюсь у него на глазах из этого револьвера».

О каких двух вариантах выхода из революции идет речь в документах?

Как вы думаете, почему Николай II был вынужден принять вариант, предложенный С.Ю. Витте?

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Представительный орган, который был образован на основании манифеста Николая II 6 августа 1905 г., избирался на основе высокого имущественного ценза без участия рабочих, носил законосовещательный характер, назывался _____________________________________

Лидером кадетов стал:

А) В. Ленин, б) В. Чернов, в) П. Милюков, г) А. Гучков

12. Программной установкой конституционно-демократической партии в форме устройства государства является ____________________________________________________________________________

13. Партия «Союз 17 октября» был образован в связи с ____________________________________________________________________________

14. Реакционные сторонники самодержавия, ярые противники революции, включающие дворян-помещиков, представители бюрократии, русского духовенства - ________________________________________________________________________________

15. Основной формой борьбы с революцией организаций Союз Михаила Архангела, Союз русского народа являются ___________________________________________________________________________

Главным итогом революции 1905-1907 г.г. можно считать:

а) ликвидацию помещичьего землевладения,

б) удовлетворение экономических требований рабочего класса,

в) появление законодательного представительного органа власти,

г) принятие конституции.

Итоги урока №7

Российский парламент. Государственная Дума.

А.Г. Булыгин

1. На какие курии было поделено общество при проведении выборов в I Государственную Думу?

___________________________________________________________________________________

Президиум I Думы. 3-й слева - С.А.Муромцев.

2. Какую функцию стал выполнять Государственный Совет после 20 февраля 1906 г.?____________

______________________________________________________________________________________

3. Какие изменения произошли после принятия 23 апреля 1906 года «Основных законов Российской империи»?__________________________________________________________________________

4. Закончи предложение:

1) В России вводился новый орган власти - ________________________________________________

_____________________________________________________________________________________

2) Он состоял из - _____________________________________________________________________

_____________________________________________________________________________________

3) Государственный Совет – это _______________________________________________________

4) Срок полномочий Думы - ______________________________________________________________

5) Срок полномочий Совета - ____________________________________________________________

6) Государственная Дума – это __________________________________________________________

5. Какие партии бойкотировали выборы в I Государственную Думу? ______________________________________________________________________________________

6. Какие слои общества не имели права участвовать в выборах и в работе в Государственной Думе?

А) рабочие;

Б) крестьяне;

В) солдаты и матросы;

Г) помещики;

Д) женщины;

Е) батраки;

Ж) буржуазия.

7. «Трудовая группа» I Государственной Думы состояла из ______________________________________________________________________________________

8. Правительство обвинило I Государственную Думу при ее роспуске:

а) в заговоре против императора-самодержца;

б) в антиправительственном заговоре;

в) в революционных замыслах;

г) в превышении полномочий.

9. По закону о выборах в I Государственную Думу для рабочих были установлены:

а) прямые тайные выборы;

б) четырехступенчатые выборы;

в) трехступенчатые выборы;

г) открытые выборы через посредников.

10. Законодательную власть в России после созыва I Государственной Думы осуществлял:

а) император,

б) Государственная дума;

в) Государственный совет;

г) все вышеперечисленное.

11. После роспуска I Государственной Думы военный бунт произошел :

а) в Мурманске,

б) в Свеаборге,

в) в Санкт-Петербурге,

г) в Севастополе.

12. Председателем I Государственной Думы являлся _________________________________________

13. Какие призывы к народу были озвучены в Выборгском воззвании: ________________________

14. Основными требованиями I Государственной Думы были:

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

Тема №8

II Государственная Дума. Государственный переворот.

Таврический дворец.

1.Укажите период работы II Государственной Думы:

а) февраль-июнь 1907 г.;

б) апрель1906 г. - июнь-1907 г.;

в) июнь 1907 г.- август 1908 г.;

г) апрель – август 1907 г.

Президиум II Думы. 3-й слева -Ф.А.Головин.

2. Центральным вопросомII Государственной Думы являлся: __________________________________________________________________________________

3. ПредседателемII Государственной Думы был: __________________________________________________________________________________

4. Представители какой партии выдвинули лозунг «Берегите Думу!» __________________________________________________________________________________

5. Положение о военно-полевых судах, утвержденное Николаем II 19 августа 1906 г. направлено на:

______________________________________________________________________________________

Премьер-министром с 1906 г. становится:

А) Горемыкин И.Л.;

Б) Столыпин П.А.;

В) Святополк-Мирский П.Д.;

Г) Головин Ф.А.

6. Предлогом роспускаII Государственной Думы стало:

А) обвинение депутатов социал-демократической фракции в подготовке государственного переворота;

Б) обвинение в превышении полномочий;

В) обвинение в заговоре против императора.

7. Программа реформирования П.А. Столыпина предполагала:

______________________________________________________________________________________

______________________________________________________________________________________

Почему Манифест 3 июня 1907 года о роспуске Думы являлся нарушением Манифеста 17 октября 1905 года? _________________________________________________________________

______________________________________________________________________________________

Тема №9

Третьиюньская монархия.

«Революция – болезнь не наружная, а внутренняя, и одними наружными лекарствами ее не вылечишь». Чьи это слова? О какой болезни идет речь? ________________________________________________________________________________

________________________________________________________________________________

Почему П.А. Столыпин считал, что Государственная Дума нужна обществу? ________________________________________________________________________________

На основании Положения о выборах, принятого 3 июня 1907 г. произошли изменения в избирательной системе. Какие сословия были наиболее представлены в III Государственной Думе?

________________________________________________________________________________

Партия, созданная в 1907 г. из числа представителей крупной буржуазии, независимой от государственных заказов - ___________________________.

В.М. ПуришкевичП.Н. Милюков

В III Государственной Думе основные партии представили различные позиции. Соотнеси:

Правыеа) трудовики, социал-демократы

Левые б) черносотенцы, октябристы

Центристы в) кадеты, прогрессисты

Председатель III Государственной Думы Н.А. Хомяков был представителем:

А) кадетов;

Б) трудовиков;

В) социал-демократов;

Г) октябристов.

7. Главным отвлекающим фактором в работе III Государственной Думы и способом проведения законов, необходимых государственной власти стал так называемый «_______________________________________».

8. Почему столыпинская политика приобрела репрессивно - карательный характер?

______________________________________________________________________________________

______________________________________________________________________________________

Дайте определение понятиям:

Государственный переворот-это ____________________________________________________

Столыпинская партия – это ________________________________________________________

Погромные герои – это ____________________________________________________________

Третьеиюньская монархия – это ____________________________________________________

Заполните таблицу:

Государственная Дума

Время работы

Председатели

Основные обсуждаемые проблемы

Тема №10.

Внутриполитическая обстановка. Реформы Столыпина.

Боевая организация, разоблаченным представителем которой являлся Е. Азеф, являлась органом:

А) партии социал-демократов;

Б) партии кадетов;

В) партии социал - революционеров.

П.Н. МилюковА.И. ГучковВ.И. Ленин

2. «Не беспощадная раздача земель. Но успокоение бунта подачками – бунт погашается силой, а признание неприкосновенности частной собственности и, как последствие, отсюда вытекающее, создание мелкой личной собственности, реальное право выхода их общины и разрешение вопросов улучшения землепользования – вот задачи, осуществление которых правительство считало и считает вопросами бытия русской державы». Кто мог быть автором этого высказывания?

А. С.Ю. Витте;В. П.А. Столыпин

Б. П.Н. Милюков; Г. Николай II

3. Социал-демократические силы представляли три новых течения:

1)____________________________________________________________________________________

2)____________________________________________________________________________________

3)____________________________________________________________________________________

4. Сборник статей «Вехи», изданный под редакцией П.Б. Струве в 1909 г. вызвал в обществе бурную полемику. Какие вопросы были затронуты известными мыслителями и общественными деятелями?

______________________________________________________________________________________

______________________________________________________________________________________

______________________________________________________________________________________

«Каждый домохозяин, за коим укреплены участки надельной земли, в порядке, установленном в статьях I-II настоящих правил, имеет право во всякое время требовать, чтобыобщество выделило ему взамен сих участков соответственный участок, по возможности, к одному месту»

Определите характер и происхождение документа.

Определите его значение для экономики страны.

Разъясните смысл выделенных слов.

___________________________________________________________________________________________________________________________________________________________________________

Разъясни понятия:

Отруб______________________________________________________________________________

Хутор _____________________________________________________________________________

Переселенческая политика ____________________________________________________________

Фракция ___________________________________________________________________________

Круговая порука ____________________________________________________________________

Чересполосица ______________________________________________________________________

На что была направлена аграрная реформа П.А. Столыпина? ________________________________________________________________________________

За счет чего решалась проблема борьбы с сельской бедностью? ________________________________________________________________________________

*Рассмотрите и проанализируйте следующие исторические факты. Сделайте выводы об удаче и неудаче аграрной реформы.

Накануне первой мировой войны население России составляло 140 млн. человек.

За 1906-1915 гг. было создано около 1 315 100 хуторских и отрубных хозяйств на площади около 13 млн. десятин.

За это время количество переселенцев на новые земли составляло чуть более 3 млн.; из них возвратилось обратно в свои края около 20%.

Всего же накануне мировой войны существовало 2,5 млн. «крепких» хозяев.

Урожайность в стране к 1915 г. возросла на 14% ( в Сибири – на 25%), экспорт зерна составлял 15,5 млн. т ( т.е. превышал на 30% экспорт США, Канады и Аргентины вместе взятых).

Ю.О. Мартов (Цедербаум)В.М. ЧерновП.Б. Струве

* Заполни таблицу, используя приведенный список:

В. К. Плеве, П.Д. Святополк-Мирский, Г.В. Плеханов, В.М. Чернов, В.И. Ленин, Николай II, К.П. Победоносцев, В.М. Пуришкевич, С.Ю. Витте, А.И. Гучков, П.А. Столыпин, М.В. Родзянко, А.Ф. Керенский, П.Н. Милюков.

Сторонники и участники проведения реформ

Сторонники сохранения существующего строя

Сторонники революционного пути развития

Тема № 11

Россия накануне Первой мировой войны

Какие из указанных стран входили в состав Антанты (1), а какие – Тройственного союза (2):

а) Австро-Венгрияз) Румыния

б) Болгарияи) Турция

в) Великобританияк) Сербия

г) Германиял) США

д) Бельгиям) Франция

е) Италиян) Япония

2. Договор 1907 г. о разграничении сфер влияния по спорным вопросам в Иране, Афганистане, Тибете был заключен между ___________________________________________

3. Договор о передаче в эксплуатацию на определенный срок природных богатств, предприятий и других хозяйственных объектов, принадлежащих государству – это _______________________________________________________________________________

4. Назови причины аннексии Австро-Венгрией Боснии и Герцеговины: ________________________________________________________________________________

5. В Балканский союз входили:

А) Болгария, Греция, Автро - Венгрия;

Б) Россия, Болгария, Сербия;

В) Болгария, Греция, Сербия;

Г) Греция, Сербия, Босния и Герцеговина.

6.Заполни таблицу:

Войны

Страны-участницы войн

Годы

Первая Балканская война

Вторая Балканская война

Итогом Балканских войн стало:_____________________________________________________

________________________________________________________________________________

Назови причину предъявления Австро-Венгрией ультиматума Сербии 28 июля 1914 г.: ________________________________________________________________________________

К какому региону относится определение «пороховой погреб Европы»? Почему он так назван? _________________________________________________________________________

________________________________________________________________________________

План Шлиффена – это ____________________________________________________________

Тема № 12.

Россия в первой мировой войне.

Крейсер «Варяг»

Планы сторон:

Страна-участница

Планы и цели страны

Россия

Германия

Англия

Франция

Австро-Венгрия

Италия

Сербия

Генерал А.А. Брусилов

2. Кто из русских генералов руководил 2-й армией, которая попала в окружение:

а) П.К. Ренненкампф; б) В.А. Сухомлинов; в) А.В. Самсонов.

3. Каковы причины поражения 1-й и 2-й русских армий в начале войны? ________________________________________________________________________________

4. В связи с чем немецкое командование изменило планы ведения войны в 1915 г.? _________________________________________________________________________________

5. Какие территории потеряла Россия в результате «великого отступления»?

______________________________________________________________________________________

6. «Если бы более 12 германских дивизий не были задержаны вдали от нашего фронта смелым наступлением русских, битва на Марне, которая сохранила Францию от краха, была бы поражением» (французский историк Б. Лавернь).

О каком периоде войны, и какой военной операции идет речь в приведенном высказывании?

_____________________________________________________________________________________

7. В прогрессивный блок входили:

А) кадеты, октябристы и оппозиционные фракции;

Б) эсдеки, эсеры, кадеты;

В) октябристы, оппозиционные партии, трудовики.

8. Заполни таблицу:

«Отношение к Первой мировой войне».

Отношение к войне

Конституционные демократы

Социал-революционеры

Социал-демократы

Октябристы

Буржуазная оппозиция

9. Разъясни понятия:

Прогрессивный блок - __________________________________________________________________

Земгор - ______________________________________________________________________________

ВПК - ________________________________________________________________________________

Брусиловский прорыв - _________________________________________________________________

Аннексия - ____________________________________________________________________________

Революционное пораженчество - _________________________________________________________

10. Какие государства в результате успешного Брусиловского прорыва были защищены Россией в 1916 г.?___________________________________________________________________________

11. Соотнесите события и даты:

а) поражение армий А.В. Самсонова и П.К. Ренненкампфа в Восточной Пруссии;

б) объявление Германией войны с Россией

в) Брусиловский прорыв

г) вступление Турции в войну с Россией

А. 19 июля 1914 г.

Б. май-июль 1916 г.

В. август - сентябрь 1914 г.

Г. 20 октября 1914 г.

12. Как повлияла Первая мировая война на дальнейшую судьбу России:

А) Сблизила государство с его западными союзниками по Антанте.

Б) Поставило вопрос о дальнейшем существовании ценностей западной цивилизации.

В) Усилила патриотические тенденции в обществе.

Г) Ускорила революционный процесс и решение вопроса о власти «снизу».

Д) Стимулировала обострение внутренних противоречий в обществе.

Тема № 13.

Русская культура конца 19 – начала 20 века

В 1899 г были введены «Временные правила», согласно которым эта категория населения, участвовавшая в беспорядках подлежала отдаче в солдаты. Это - ________________________.

По инициативе торговой и промышленной буржуазии в России была создана сеть средних учебных заведений. Это - _________________________________________________________.

Рост численности периодической печати в России в начале века был связан с _______________________________________________________________________________.

И.Д. Сытин, А.С. Суворин были выдающимися _______________________________________.

Теорию рефлексов разработал русский ученый:

а) К.А. Тимирязев, б) И.И. Мечников, в) И.П.Павлов, г) В.И.Вернадский.

Нобелевским лауреатом за исследования в области иммунологии, микробиологии, патологии был:

А) В.И. Вернадский, б) К.А. Тимирязев, в) П.Н. Лебедев, г) И.И. Мечников.

7. «Работая над реактивными приборами, я имел мирные и высокие цели: завоевать Вселенную для блага человечества, завоевать пространство и энергию, испускаемую Солнцем…Всегда вперед, не останавливаясь – вперед. Вселенная принадлежит Человеку». Кто произнес эти слова? ______________________________________________________________________________________

8. Соотнеси:

В.И. Вернадский

Теория ракетного строения и космонавтики

Н.Е. Жуковский

Религиозная философия

К.Э. Циолковский

Лекционный курс по русской истории

А.А. Шахматов

Воздухоплавание, гидро-, аэродинамика

В.С. Соловьев

Биохимия, биогеохимия, радиогеология

В.О. Ключевский

Русское языковедение

9. Заполни таблицу, используя приведенный список:

В.Я. Брюсов, А.А. Блок, Л.Н. Толстой, А.П. Чехов, Н.С. Гумилев, А.И. Куприн, А. Белый, Л.Н. Андреев, А.Н. Толстой, К.Д. Бальмонт, И.А. Бунин.

Писатели – реалисты

Представители модернистских течений

Раскрой понятия и термины:

Импрессионизм –______________________________________________________________________

«Мир искусства» - ______________________________________________________________________

«Союз русских художников» _____________________________________________________________

Модернизм - __________________________________________________________________________

Символизм - ___________________________________________________________________________

Акмеизм - _____________________________________________________________________________

Футуризм - ____________________________________________________________________________

Соотнеси:

Музыка а) И.Э. Грабарь, К.Ф. Юон, А.Н. Бенуа, М.А. Врубель, К.А. Сомов

Архитектура б) А.Н. Скрябин,. И.Ф. Стравинский, С.В Рахманинов.

Живопись в) Ф.И. Лидваль, А.В. Щусев, Ф.О. Шехтель

Среди видных русский поэтов «Серебряного века» можно назвать:

а) А.П. Чехова, А.М. Горького, И.А. Бунина, А.И. Куприна, Л.Н. Андреева, А.Н. Толстого

б) А. Блока, А. Белова, Н. Гумилева, А. Ахматову, В. Брюсова, В. Маяковского

в) К.С. Станиславского, В.И. Немировича-Данченко, Ф.В. Комиссаржевскую, Е.Б.Вахтангова, А.Я. Таирова, В.Э. Мейерхольда

г) Н.А. Бердяева, П.А. Флоренского, С.Н. Булгакова, С.Н.Трубецкого, Е.Н. Трубецкого, С.Л. Франка.

Тематическая контрольная работа №14 по теме:

«Россия в началеXX века».

Главным морским сражением русско-японской войны, в ходе которого русский флот потерпел полное поражение, была:

а) Чесменская битва; б) Цусимская битва; в) битва при Мукдене; г) Синопская битва.

«Зубатовщиной» в начале XX века называли:

а) крайне экстремистское направление в рабочем движении;

б) применение в полиции попыток во время следствия;

в) крестьянское восстание под предводительством атамана Зубатова;

г) попытку полиции взять под контроль рабочее движение.

Причинами быстрого развития капиталистических отношений в России в начале XX века была:

а) благоприятная конъюнктура цен на лес и зерно на мировом рынке;

б) протекционистская политика русского государства и приток в Россию иностранного капитала;

в) победа России в русско-турецкой войне 1877-1878 гг.

г) присоединение к России во 2-й половине XIX века.

Началом первой русской революции стала (стало):

а) восстание на броненосце «Потемкин» 14-25 июня 1905 г.

б) восстание в Свеаборге 17-20 июля 1906 г.

в) «кровавое воскресенье» 9 января 1905 г.

г) декабрьское вооруженное восстание в Москве 2 - 19 декабря 1905 г.

Консервативный (правительственный) лагерь во время 1-й русской революции представляли:

а) «Союз русского народа» и другие «черносотенные» партии;

б) партии кадетов, октябристов и другие буржуазные партии;

в) РСДРП ( большевики и меньшевики), а также партии эсеров;

г) анархистские организации и партия эсеров-максималистов.

В царском Манифесте 17 октября 1905 г. говорилось о:

а) необходимости прекратить все забастовки, демонстрации и прочие беспорядки под угрозой применения вооруженной силы;

б) намерении создать выборный совещательный орган при Государственном Совете для предварительного обсуждения законопроектов;

в) отречении Николая II от престола в пользу брата Михаила;

г) даровании населению демократических прав и свобод, а также о создании в ближайшее время парламента и постоянно действующего правительства.

Главной причиной Первой мировой войны было:

а) убийство сербским террористом Г. Принципом наследника австрийского престола эрцгерцога Франца Фердинанда;

б) недовольство Германией объявленной в России всеобщей мобилизацией;

в) стремление ведущих мировых держав в России всеобщей мобилизацией;

г) стремление ведущих мировых держав к территориальному и экономическому переделу мира.

Основными модернистскими течениями русской поэзии начала XX века являлись:

а) классицизм, сентиментализм, романтизм

б) импрессионизм, кубизм, абстракционизм

в) символизм, акмеизм, футуризм

г) барокко, рококо, ампир.

Конец XIX – начало XX века вошел в историю русской литературы и искусства, как:

а) Золотой век;

б) Серебряный век;

в) Каменный век;

г) Бронзовый век.

Картели, синдикаты, тресты – это:

а) государственные органы, осуществляющие управление промышленностью

б) основные виды промышленных монополий

в) общественные организации банкиров и предпринимателей

г) виды производственных кооперативов.

Началом периода третьеиюньской монархии является:

а) царский указ о разрешении крестьянам выходить из общины

б) назначение Председателем Совета Министров П.А. Столыпина

в) поражение декабрьского вооруженного восстания в Москве

г) роспуск НиколаемII 2-й Государственной Думы.

Избирательный закон 3 июня 1907 г. обеспечивал преобладание в Государственной Думе депутатов от:

а) буржуазии;

б) помещиков;

в) крестьян;

г) рабочих.

Основными странами – участницами блока «Антанта» были:

а) Германия, Австро-Венгрия, Турция

б) Германия, Италия, Япония

в) Англия, Франция, Россия.

Наиболее многочисленным классом в России началаXX века был класс ______________________________________________

Русский крейсер, героически погибший в неравном бою с японской эскадрой в первый день русско-японской войны, назывался _______________________________________________________

Противниками Антанты в Первой мировой войне были:

а) Англия, Франция, Россия и США;

б) Германия, Австро-Венгрия и Италия;

в) Германия Австро-Венгрия, Турция и Болгария;

г) Германия, Италия и Япония.

Первые в истории Советы рабочих депутатов возникли во время 1-й русской революции в городе ____________________________

Успешными операциями русской армии были:

а) Восточно-Прусская операция и Горлицкий прорыв

б) Галицийская операция и Брусиловский прорыв

в) бои на территории Румынии после вступления ее в войну

г) сражение на Марне и Верденская операция.

Соотнеси даты и события:

а) Первая русская революция 1. 1914-1918 гг.

б) Начало Третьеиюньской монархии 2. 1905-1907 гг.

в) Русско-японская война 3. 1904-1905 гг.

г) Первая мировая война 4. 03.07.1907 гг.

ТЕМА: ВЕЛИКАЯ РОССИЙСКАЯ РЕВОЛЮЦИЯ. СОВЕТСКАЯ ЭПОХА

Первая российская революция 1905-1907 гг.

Тема №1.

Начало революции.

Каковы причины описанных событий?

В 1916 г. в России был отменен закон, ограничивающий рабочий день 11, 5 часа. В 2 раза упала реальная зарплата рабочих, за год было 1 400 стачек. Число их участников – более 1 млн. человек. Резко сократилось сельскохозяйственное производство.

Причинами революционных событий февраля 1917 г. стало:

Поводом революционных событий февраля 1917 г. стало:

Объясни термины:

Двоевластие –__________________________________________________________________

Временный комитет –____________________________________________________________

Петроградский Совет рабочих депутатов –__________________________________________

Временное правительство - _______________________________________________________

Исполком Петроградского Совета рабочих депутатов

Вставь пропущенные термины:

«Вечером в Таврическом дворце открыл свои заседания ________________________________ из представителей петроградского пролетариата и революционной армии. Председателем был избран депутат __________________, товарищами депутата Керенский и Скобелев» (28 февраля 1917 г ). Какой орган был образован и кто его возглавил?_______________________

_______________________________________________________________________________

В революционном лагере главенствующие позиции заняли: _____________________________

________________________________________________________________________________

«… В эти решительные дни в жизни России почли МЫ долгом совести облегчить народу НАШЕМУ тесное единение и сплочение всех сил народных для скорейшего достижения победы и, в согласии с Государственною Думою признали МЫ за благо ____________________________________»

А) начать новое наступление на фронте;

Б) сложить с себя Верховное главнокомандование;

В) распустить Государственную Думу;

Г) отречься от престола.

Временное правительство

8. 2 марта 1917 г. было образовано Временное правительство, возглавляемое _______________.

9. Найди лишнее. Приказ №1, изданный 1 марта 1917 г.:

А) запрещал исполнять приказы, противоречащие революционным силам;

Б) ограничивал единоначалие офицеров в армии;

В) предписывал немедленное создание в воинских частях выборные солдатские комитеты;

Г) предписывал участие в Учредительном собрании.

Совет министров Временного правительства

10. «Февральское восстание именуется стихийным… в феврале никто заранее не намечал путей переворота; никто не голосовал по заводам и казармам вопроса о революции; никто сверху не призывал к восстанию. Накоплявшееся в течение годов возмущение прорвалось наружу, в значительной степени неожиданно для самой массы» (Троцкий Л.Д.) Какое место занимали политические партии в революционных событиях и почему?

____________________________________________________________________________________________________________________________________________________________________________

______________________________________________________________________________________

Тема №2

Политические партии и развитии России. Политика Временного правительства.

Разнообразие политических взглядов было представлено следующими взглядами различных политических сил. Соотнеси их.

Политические силы

Политические взгляды

Кадеты

А. поднятие вооруженного восстания, создание Революционного правительства и готовность к незначительной поддержке Временного правительства.

Умеренные социалисты

Б. установление демократической парламентской республики, обеспечение единовластия Временного правительства, ведение войны до победного конца. Единая и неделимая Россия, принудительный выкуп части помещичьих земель государством.

Анархисты

В. поддержка Временного правительства, сотрудничество с буржуазными партиями, во внешней политике – «революционное оборончество» (война для защиты революции).

Большевики

Г. поднятие вооруженного восстания для свержения Временного правительства, «безвластное общество».

Вставь нужное понятие:

Программа Временного правительства направлена на проведение широкой ___________________. Об этом свидетельствует курс на подготовку к выборам в Учредительное собрание на основе всеобщего, прямого, равного и тайного голосования. Была отменена_________________________, На местах введены должности ____________________. Репрессивной мерой стал _______________ министров. Сохранялся принцип ____________________ права. В аграрной политике введен закон, позволяющий ________________________ при народных волнениях. Началась разработка рабочего законодательства о __________________________________. Отмена ограничений в острых социальных вопросах ____________________ и __________________ стали важным фактором развития Общества.

(арест, преемственность, профсоюзы, смертная казнь, возмещение убытков, вероисповедание, национальность, демократизация, комиссары).

Определи причины, в результате которых Временное правительство потеряло устойчивое положение в обществе: ___________________________________________________________

_______________________________________________________________________________

Чем было обусловлено незамедлительное признание новой власти в лице Временного правительства великими державами?_______________________________________________

Какие действия, на ваш взгляд, являлись незавершенными в программных мероприятиях Временного правительства? ________________________________________________________

У. Черчилль «… В течение почти трех лет она (Россия) задерживала на своих фронтах больше половины всех неприятельских дивизий и в этой борьбе потеряла убитыми больше половины, чем все прочие союзники, взятые вместе. Победа Брусилова в 1916 г. оказала важную услугу Франции и особенно Италии; даже летом 1917 г., уже после падения царя, правительство Керенского все еще пыталось организовать наступление, чтобы помочь общему делу».

Какую внешнюю политику проводила Россия в период революционных событий? Все ли политические силы поддерживали эту политику? ________________________________________________________________________________

________________________________________________________________________________

Тема № 3.

Обострение внутренних проблем общества.

«…Своеобразие текущего момента в России состоит в переходе от первого этапа революции, давшего власть буржуазии, в силу недостаточной сознательности и организованности пролетариата, - ко второму этапу, который должен дать власть в руки пролетариата и беднейших слоев крестьянства». Назовите автора этого высказывания.

А) А.И. Гучков

Б) П.Н. Милюков

В) В.М. Чернов

Г) В.И. Ленин

Д) А.Ф. Керенский

Перечисли несколько причин неготовности Временного правительства своевременно решать назревшие проблемы:

«Земля – крестьянам, хлеб – голодным, свобода – угнетенным!» - лозунг ______________________ партии.

Главным властным органом государства, провозглашенным В.И. Лениным должны стать ___________________________.

Основные программные установки большевиков, предложенные В.И. Лениным в апреле 1917 г.:

По вопросу о земле:______________________________________________________________

По вопросу о войне: ______________________________________________________________

По отношению к Временному правительству: ________________________________________

По отношению к эсерам и меньшевикам:_____________________________________________

Причиной первого кризиса власти являлось:

________________________________________________________________________________

Понятия:

«Апрельские тезисы»-_____________________________________________________________

Коалиционное правительство-______________________________________________________

РСДРП-_________________________________________________________________________

Национализация-_________________________________________________________________

Социализм-______________________________________________________________________

Учредительное собрание-__________________________________________________________

ЦИК____________________________________________________________________________

Определите, когда и по какому поводу на улицах Петрограда можно было увидеть многочисленные лозунги: «Долой десять министров-капиталистов!», «Долой войну!», «Вся власть Советам!»:

_______________________________________________________________________________

________________________________________________________________________________

Чем закончилась военная операция на Юго-Западном фронте в июне 1917.?

А) победой русских войск;

Б) поражением русских войск;

В) позиционной войной.

10. Соотнеси даты и события:

1) Тактика действий большевиков, сформулированная В.И. Лениныма) июнь 1917 г.

2) Первый съезд Советов б) 4 апреля 1917 г.

3) Первый кризис властив) 18 апреля 1917 г.

Тема №4

От демократии к диктатуре.

Причиной июльского кризиса 1917 г. власти стало: ________________________________________________________________________________

Главой второго коалиционного правительства стал: ________________________________________________________________________________

Какие политические силы поддерживали нового главу Временного правительства? ________________________________________________________________________________

Почему намерения большевиков свергнуть власть Временного правительства вооруженным путем не встретило поддержки у членов ЦК? ________________________________________________________________________________

Какие меры приняты новым правительством для обеспечения порядка в армии?____________

________________________________________________________________________________

Снятие лозунга «Вся власть Советам!» и провозглашение большевиками курса на захват власти вооруженным путем произошло:

А) июнь 1917 г.

Б) конец июля - август 1917 г.;

В) август 1917 г.

7. Понятия:

Революционная анархия - _______________________________________________________________

«бонапартистская политика» - ____________________________________________________________

Государственное совещание -_____________________________________________________________

Центральная Рада- _____________________________________________________________________

Автономия - ___________________________________________________________________________

Временный совет Российской республики-_________________________________________________

Дуумвират - __________________________________________________________________________

«Дикая дивизия»-_______________________________________________________________________

Директория -___________________________________________________________________________

8.Соотнеси:

1) А.Ф. Керенскийа) лидер большевиков

2) Л.Г. Корниловб) руководитель Межрайонного отделения РСДРП

3) В.И. Ленинв) глава второго коалиционного правительства

4) Л.Д. Троцкийг) Верховный главнокомандующий с 18 июля 1917 г

5) А.М. Крымовд) генерал русской армии

9. Назови авторов этих призывов к населению. В связи с какими событиями они были написаны?

Александр Федорович Керенский

« 26 августа ген. Корнилов прислал ко мне члена Гос. Думы Вл. Ник. Львова с требованиями передачи Временным правительством ген. Корнилову всей полноты гражданской и военной власти с тем, что им, по личному усмотрению, будет составлено новое правительство для управления страной…»

« Телеграмма министра-председателя за №4163 во всей своей первой части является сплошной ложью. Не я послал члена Государственной Думы Владимира Львова к Временному правительству, а он приехал ко мне как посланец министра-председателя…

Русские люди, великая Родина умирает!

Близок час кончины!»

______________________________________________________________________________________

______________________________________________________________________________________

А.М. Крымов

Закончи предложение:

С 1 сентября 1917 г. Россия провозглашена __________________________________________.

14 сентября 1917 г. было созвано из представителей социалистических партий, земств, городских дум, профсоюзов _______________________________________________________.

Постоянно действующим органом был избран _______________________________________.

Третий политический кризис власти Временного правительства произошел _______________________________.

Предпарламент одобрил создание нового коалиционного правительства, которое приступило к работе 25 сентября 1917 г. из числа_______________________________________________.

Тема №5

Взятие власти большевиками.

Общенациональный кризис осенью 1917 г. как проявился:

В деревне _______________________________________________________________________

В городе________________________________________________________________________

В армии_________________________________________________________________________

В финансовой системе_____________________________________________________________

В промышленности_______________________________________________________________

Курс большевиков в сентябре 1917 г. был направлен на ________________________________________________________________________________

________________________________________________________________________________

Необходимость ревизии курса большевиков предлагали члены ЦК Г.Е. Зиновьев и Л.Б. Каменев.

Каковы причины их сомнений? Чем они обусловлены?_________________________________

________________________________________________________________________________

Чьи слова приведены? Какие аргументы приводит автор в пользу осуществления пролетарской революции?

«Мы стоим в преддверии всемирной пролетарской революции. И так как мы, русские большевики, одни только из всех пролетарских интернационалистов всех стран, пользуемся сравнительно громадной свободой, имеет открытую партию, десятка два газет, имеет по всей стороне столичные Советы рабочих и солдатских депутатов, имеет на своей стороне большинство народных масс в революционное время, то к нам поистине можно и должно применить слова: кому много дано, с того много спросится».

«Мы имеем тысячи вооруженных рабочих и солдат в Питере, кои могут сразу взять и Зимний дворец, и Генеральный штаб, и станцию телефонов, и все крупные типографии… Если бы мы ударили сразу, внезапно, из трех пунктов, в Питере, в Москве, в Балтийском флоте, то девяносто девять сотых за то, что мы победим».

________________________________________________________________________________

________________________________________________________________________________

________________________________________________________________________________

Понятия:

ВРК-____________________________________________________________________________

РСДРП(б)-_______________________________________________________________________

Второй съезд Советов-____________________________________________________________

СНК-___________________________________________________________________________

ВЦИК-__________________________________________________________________________

Соотнеси:

Л.Д. Троцкийа) председатель СНК

А.И. Рыковб) нарком иностранных дел

И.В. Сталинв) нарком просвещения

А.В. Луначарский г) председатель ВЦИК

В.И. Ленинд) нарком по делам национальностей

Л.Б. Каменеве) нарком внутренних дел

Представителями самых крупных политических партий, участвовавших во Втором съезде Советов 25 октября 1917 г. были: ___________________________________________________

На Втором съезде Советов были выдвинуты лозунги и предложения:

«Вся власть Советам!»

«Вся власть демократии!»

За коалицию с буржуазными партиями.

Почему не было единодушия в установлении власти Советов среди участников съезда?

________________________________________________________________________________

Почему меньшевики и эсеры покинули заседание съезда?_______________________________

________________________________________________________________________________

Выступление В.И. Ленина на Втором съезде Советов

Назови основные положения документов:

Декрет о мире

Декрет о земле

Назови причины прихода к власти большевиков:

________________________________________________________________________________

________________________________________________________________________________

________________________________________________________________________________

«Не подлежит сомнению, что многие из вас рады тем событиям, благодаря которым пало коалиционное правительство А.Ф. Керенского, и политическая власть перешла в руки Петроградского Совета Рабочих и Солдатских Депутатов.

Скажу вам прямо: меня эти события огорчают.

Не потому огорчают, что я не хотел торжества рабочего класса….

… наш рабочий класс еще далеко не может с пользой для себя и для страны взять в свои руки всю полноту политической власти…. В населении нашего государства пролетариат составляет не большинство, а меньшинство…» (Г.В. Плеханов)

Согласны ли вы с утверждением автора? Почему?

______________________________________________________________________________________

Тема №6

Утверждение и формирование советской власти.

В Комитет спасения родины и революции, созданный в Петербурге 26 октября 1917 г. входили:________________________________________________________________________

Почему ВРК Москвы удалось установить власть в кроткие сроки? ________________________________________________________________________________

Победа Советской власти:

Заполни таблицу:

Территории

Сроки установления Советской власти

Петербург

Москва

Центральные промышленные районы России

Территории Дона, Кубани, Южного Урала

Север, Сибирь, Дальний Восток

Армия и флот

Прибалтика

Закавказье

Украина

Крым и Средняя Азия

Найди лишнее. Причинами победы большевиков стали:

А) популярность принятых первых Декретов;

Б) разобщенность антибольшевистских сил;

В) принятие Декларации прав народов России;

Г) Обращение к трудящимся мусульманам Востока;

Д) взаимодействие большевиков с меньшевиками и эсерами;

Е) курс большевиков на созыв Учредительного собрания.

Какие политические силы одержали наибольшее количество голосов в выборах в Учредительное собрание?_______________________________________________________________________

Высшим законодательным органом советской власти стал______________________________

Закончи предложение:

Постоянно действующим законодательным органом был _______________________________

Высшим исполнительным органом советской власти являлся____________________________

Центральными органами государственного управления были ___________________________

Для борьбы с контрреволюцией был создан __________________________________________

В связи с каким событием были сказаны эти слова и кто их сказал?

«Прошу немедленно покинуть зал, караул устал!»_____________________________________
________________________________________________________________________________

В ноябре 1917 г. Совнарком одобрил декрет, объявивший «партией врагов народа» партию ________________________________________________________________________________

6 января 1918 г. вышел декрет ВЦИК о роспуске Учредительного собрания по причине:

А) отсутствия кворума;

Б) несовместимости с задачами осуществления социализма;

В) наличия членов партии «врагов народа»;

Г) не поддержания Декларации прав трудящегося и эксплуатируемого народа.

11. РСФСР - ___________________________________________________________________

12. Объединение Советов рабочих и солдатских депутатовc Советами Крестьянских депутатов произошла на __________________________________________________________________________

13. Конституция РСФСР была принята ________________________________________________

14. Основными положениями Конституции стали: ______________________________________

_______________________________________________________________________________

Железняк А.

Адрес публикации: https://www.prodlenka.org/metodicheskie-razrabotki/106209-praktikum-po-istorii-rossii-v-11-klasse-nacha

Отношение к дворянскому землевладению витте таблица

Позиции государственных деятелей

Скачать
презентацию

Позиции государственных деятелей России Сергея Юльевича Витте(министра финансов) и Вячаслава Константиновича Плеве (министра внутренних дел) во внутренней политике государства в начале XX века. Параметры для сравнения. Витте. Плеве. Отношение к дворянскому помещичьему землевладению. Сохранение дворянского (помещичьего) землевладения, включение разоряющихся дворян к занятиям промышленностью и финансовой деятельностью. Укрепление положения дворянства всемирной поддержкой казны, дарование дополнительных привилегий (дворянские кассы взаимопомощи). Позиция по крестьянскому вопросу. Переселение землепашцев на окраины империи, отмена совместной ответственности членов сельской общины за уплату налогов, выход из общины крестьян. Сохранение крестьянской общины и сословной обособленности крестьян, традиционного образа жизни. Позиция по рабочему вопросу. Принятие законов, разрешение всех спорных вопросов между работодателем (капиталом) и рабочим (трудом) на основе законодательства. Попечительская политика по отношению к рабочим, разрешение экономической борьбы под контролем полиции (зубатовский социализм), создание касс взаимопомощи рабочими.

Слайд 7 из презентации «Русско-японская война и революция». Размер архива с презентацией 1804 КБ.

История 11 класс

«Югославия» — Ныне друг от друга независимы. Сербия Хорватия Македония Черногория Словения Босния и Герцеговина. Государство в Юго-Восточной Европе, имевшее на разных этапах своей истории различные названия. В разные времена — разные страны. Югославия 1945 год начало 21 века. Флаг 1943-1992 Флаг 1992-2003 Герб 1943-1992 Герб 1992-2003. Экономика. Тито Иосиф Броз.

«И.В.Сталин» — Зиновьев. Оппозиционеры. И.В. Сталин. Личная жизнь Сталина. Изменение жизненного уровня. Развитие экономики. Гражданская война. Сталинизм и диктаторский режим. Женщина. Послушники. Мифы о Сталине. Сталин и евреи. Создание атомной бомбы. Смерть Сталина. Воспитанник Горийского духовного училища. Великая Отечественная война. Сталин и культура современников. Иосиф Виссарионович Сталин. Сталин как личность.

«НЭП кратко» — Определение НЭПа. Проблемный вопрос. НЭП. Творческая жизнь. Новая экономическая политика. Собачий нюх. Максимальный подъем. Двенадцать стульев. Эпиграф. Экономика весны. Сельское хозяйство.

«Тест по Второй мировой войне» — Варшава. Венгрия. Вступление США в войну. Название военных операций. Раскройте содержание понятия. Вторая Мировая война. Последовательность событий. Ось Берлин – Рим – Токио. Эйзенхауэр. Политика умиротворения агрессора. Жуков. Приведите в соответствие. Вопрос о территории. Ариизация. Второй фронт. Битва под Москвой.

«Победа под Сталинградом» — Наступление холодов. В плен были взяты более 2500 офицеров. Дата начала. Сильная оборона. Зачем Гитлеру Сталинград. Командование принимает Рокоссовский. Решающее наступление. Эвакуация. Операция «Малый Сатурн». Директива генштаба. Тяжелые бои. План по окружению. Подготовка советских войск к контрнаступлению. Презентация. Недовольство Сталина. Капитулировали в общей сложности двадцать немецких дивизий.

«Культура Великой Отечественной войны» — Музыка. 10 писателей были удостоены звания Героя Советского Союза. «Секретарь райкома». Актриса – Вера Марецкая. Громадный ущерб был нанесен Ленинграду. «Полтавская битва». Первое место в графике военных лет занимал плакат. Многие культурные потери восполнить было невозможно. Гитлеровцы проводили целенаправленную политику по уничтожению населения. В живописи военных лет в первую очередь развивается жанр портрета.

Всего в теме «История 11 класс» 49 презентаций

Источник

Отношение к дворянскому землевладению витте таблица

Социальная политика царизма не претерпела каких-либо принципиальных изменений по сравнению с предшествовавшим периодом. Она оставалась консервативной по своему характеру, была направлена на сохранение и укрепление той социальной структуры общества, которая, по мнению правя­щих верхов, всего более способствовала стабильности и порядку. В основе этой политики находился принцип сословности. Для царя и его окружения Россия виделась страной главным образом двух со­словий — дворянства и крестьянства. Но капиталистическое раз­витие вносило свои коррективы в социальную структуру общества, порождая неоднородность в традиционных слоях и формируя но­вые — буржуазию и пролетариат, заставляло власти обращать вни­мание в какой-то мере и на эти последние.

Накладывало свой отпечаток на социальную политику прави­тельства и нараставшее в стране революционное движение. Чтобы успешнее противостоять своим политическим противникам в борь­бе за массы, власти стремились активизировать и распространить шире свою традиционную попечительскую политику, использовать ее, в частности, в отношении проявлявших все большее недоволь­ство рабочих и студентов. Подобная политика сводилась в основном к незначительным экономическим уступкам и частичному удовле­творению духовных запросов этих слоев населения, а также их потребности в профессиональной организации. Вместе с тем она свидетельствовала о стремлении государства усилить свою роль и в регулировании социальных отношений.

Николай II, подобно своим предшественникам на престоле, проявлял особую заботу о поместном дво­рянстве, которое он считал «исконным оплотом порядка ,и нравст­венной силой России». Дворянский вопрос стал предметом обсуждения ряда совещаний правящих кру­гов с представителями дворянства: всероссийского съезда сельских хозяев (январь 1896 г.), совещания губернских предводителей дво­рянства (февраль-март 1896 г.), дискуссий 1897 г. об «оскудении» Черноземного центра, «комиссии Центра» (1899-1901) и Особого совещания о нуждах дворянского сословия (1897-1901).

На Особом совещании выявились значительные разногласия не только в дворянстве, но и среди правящей бюрократии, прежде всего между С. Ю. Витте и В. К. Плеве.

Взгляды Витте были эклектичны, противоречивы и подверже­ны конъюнктурным влияниям. До назначения министром финансов он разделял основные положения славянофильской теории об осо­бом пути развития России. Затем его взгляды претерпели значи­тельные изменения в сторону западничества. Своеобразным было отношение Витте к самодержавию. Будучи его сторонником, он вместе с тем не обожествлял его, не считал властью, данной России Богом раз и навсегда. Самодержавие он рассматривал как власть, исторически преходящую, которая должна была измениться с пе­ременой общественных условий. Самодержавие он ценил прежде всего как систему жестко централизованной власти. Лишь такая власть, по его мнению, была способна решить проблемы модерниза­ции страны, преодолеть ее отсталость. Поэтому до начала первой революции он выступал противником малейших попыток ограни­чения самодержавия, считал несовместимым с ним даже земство. Витте пытался представить самодержавие как власть надсословную, ставящую интересы страны выше интересов какого-нибудь одного класса или сословия, в том числе и дворянства. Пользуясь прежде всего этим аргументом, Витте вначале убеждал Николая II отказаться от затеи созыва Особого совещания о нуждах дворянст- ( ва, однако его попытка успеха не имела.

В ходе работы совещания Витте доказывал, что его труды не нужны и тщетны, так как ложна и неосуществима сама цель совещания — изыскать пути и средства для возрождения старозавет­ного дворянства. Пути развития России и Западной Европы, под­черкивал он, однотипны и гибельными являются иллюзии о само­бытности и исключительности России. Дворянство есть продукт фео­дализма, который в Западной Европе уже сменился капитализмом, и эта смена является мировым непреложным законом. По этому закону развивается и Россия. Лет через 50 дворянство, если оно по-прежнему будет связывать себя с землевладением и службой, пол­ностью оскудеет и потеряет свои привилегии, не выдержав конку­ренции с новыми богачами — банкирами и промышленниками. Спа­сение дворянства и страны Витте видел не в том, чтобы возродить былое положение дворянства и «одворянить» буржуазию, а в том, чтобы «обуржуазить» дворянство, переориентировать его интересы с земли на промышленность и банковское дело.

Однако Витте в своем понимании неизбежности смены тра­диционного аграрного строя индустриальным был в то время оди­нок не только среди участников совещания, но и во всей правящей бюрократии. Его доводы общесоциологического характера не нахо­дили понимания и оставляли равнодушными большинство участников совещания, которое не заглядывало так далеко вперед, жило теку­щими интересами. Главным оппонентом Витте выступал В. К. Плеве, лидер реакционно-консервативного меньшинства. Витте был нена­вистен этой части правящего сословия не только своими мрачными пророчествами относительно его будущего, но и своей финансово-экономической политикой, препятствовавшей превращению госу­дарственного казначейства в кассу помощи этому дворянству.

Возражая Витте, Плеве прежде всего ставил под сомнение его идею о существовании всеобщих непреложных мировых законов общественного развития. Называя их «гадательными», он считал, что рассуждения о них уместны лишь в студенческой среде. Рос­сия, по мнению Плеве, развивалась особым путем и имеет все осно­вания сохранить свою самобытность. Она будет избавлена от «гнета капитала и буржуазии» и будущее в России останется за дворянст­вом. Во имя этого правительству в своей социальной политике не­обходимо руководствоваться прежде всего не экономическими, а политическими соображениями, укреплять пошатнувшееся поме­стное дворянство, учитывая, что оно является опорой власти и хра­нителем нравственности на местах.

Разногласия, проявившиеся на совещании, обусловили то, что хотя оно и проработало целое пятилетие, результаты его были весьма скромны и далеко не соответствовали притязаниям консервативно-охранительной части поместного дворянства. Прежде всего ему не удалось в угоду своих интересов изменить общий курс финансово-экономической политики. По итогам работы совещания были изда­ны законы: о насаждении дворянского землевладения в Сибири, о заповедных имениях, об учреждении дворянских касс взаимопомо­щи. Несколько ограничен был доступ в дворянское сословие и расширены права дворянских обществ. Ряд попечительных мер было принято по отношению к оскудевшим дворянам. Решено было, в частности, учредить дворянские пансион-приюты, военные школы, особые стипендии для студентов из дворян. Примечательно то, что наиболее значимые для дворян законы — о заповедных имениях и о насаждении дворянского землевладения в Сибири — остались на бумаге, не имели практических последствий.

Таким образом, социальная политика самодержавия по отно­шению к дворянству носила в известной мере компромиссный ха­рактер, учитывавший, с одной стороны разнородность интересов и противоречия между различными группами дворянства, а с дру­гой, — противоречия между общегосударственными интересами, требовавшими перехода страны от традиционного, аграрного строя к индустриальному ради сохранения ею экономического и военного могущества, статуса мировой державы, и узкосословными интере­сами поместного консервативного дворянства, не принимавшего нового, мечтавшего о восстановлении дореформенных порядков. Но такой компромисс не удовлетворял, а лишь усиливал недовольство и либерального, и консервативного дворянства, ослаблял тем са­мым основную социальную базу царизма.

Ослабление позиций поместного дворянства под воздействием капитализма, нарастание противоречий в нем, усиливавшийся раз­лад между правящими верхами и их социальной опорой, разногла­сия в этих верхах по вопросу об отношении к дворянству — все это являлось признаками кризиса власти, одним из важных свидетельств складывавшейся в это время революционной ситуации. Правитель­ство, как отмечалось выше, уже не могло полностью подчинить свою социально-экономическую политику консервативному дворянству. Но тот факт, что интересы именно этого дворянства оставались приоритетными для правительства, лишало его способности адек­ватно ответить на вызов времени, обеспечить быстрый и эффек­тивный переход страны от аграрного способа производства к инду­стриальному.

Источник

План войны >>

Исследование окружающей среды и поведение гороховой тли при колонизации, связанное с экспрессией гена кормления

Abstract

Тля реагирует на определенные сигналы окружающей среды, производя альтернативные морфы, явление, называемое полифенизмом, а также модулируя свое индивидуальное поведение даже в пределах одной и той же морфы. Эта сложная пластичность позволяет быстро адаптироваться к меняющимся условиям окружающей среды, но лежащие в основе генетические и молекулярные механизмы остаются в значительной степени неизвестными.Известно, что ген поиска пищи связан с поведением у различных видов и, как было показано, опосредует сдвиг в поведении, вызванный изменениями окружающей среды у некоторых насекомых. В этом исследовании мы исследовали функцию этого гена в клональных формах гороховой тли Acyrthosiphon pisum путем идентификации и клонирования вариантов кДНК, а также анализа уровней их экспрессии в морфах развития и вариантах поведения. Наши результаты показывают, что экспрессия фуражиров изменяется на ключевых этапах развития тли.Этот ген также высоко экспрессируется у оседлых бескрылых взрослых особей, выращенных в условиях скопления людей, вероятно, непосредственно перед тем, как они начнут ходить и собирать пищу. Активность фермента цГМФ-зависимой протеинкиназы (PKG), измеренная в поведенческих вариантах, коррелирует с уровнем экспрессии при кормлении . В целом, наши результаты показывают, что добывающих пищу могут способствовать переходу от оседлого к исследовательскому поведению, таким образом участвуя в пластичности поведения гороховой тли.

Образец цитирования: Tarès S, Arthaud L, Amichot M, Robichon A (2013) Исследование окружающей среды и поведение гороховой тли при колонизации, связанное с экспрессией гена , добывающего пищу. PLoS ONE 8 (5): e65104. https://doi.org/10.1371/journal.pone.0065104

Редактор: Вульфила Гроненберг, Университет Аризоны, Соединенные Штаты Америки

Поступила: 6 августа 2012 г .; Принята к печати: 25 апреля 2013 г .; Опубликован: 29 мая 2013 г.

Авторские права: © 2013 Tarès et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа финансировалась Департаментом INRA "Santé des Plantes et Environnement" и частично поддерживалась ANR "Exdisum". Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Тля - это насекомое, которое быстро реагирует на изменения окружающей среды, развивая альтернативные фенотипы, такие как бесполые и половые формы, явление, называемое полифенизмом. Бесполые клональные формы, полученные в течение всей весны и лета, вырабатывают эффективные стратегии адаптации к меняющимся условиям окружающей среды. В условиях пониженного количества или качества пищи или при нападении хищников клональные формы могут в двух поколениях переключаться с бескрылых на крылатые формы, которые легко колонизируют новые растения-хозяева [1], [2].В дополнение к производству крылатых морфов, которые отвечают за дисперсию на большие расстояния, клональные формы способны реагировать за очень короткое время, используя альтернативные способы ускользания для дисперсии на короткие расстояния. Некоторые тли действительно покидают свое растение-хозяин и начинают исследовать свою близкую среду, чтобы найти свежие ресурсы и немедленно заселить новые колонии [3], [4] Высвобождение летучих соединений, таких как феромон тревоги, выделяемый тлями в присутствии хищников. , также запускает различные реакции, такие как отрыв стилета от растения, ходьба или опускание с растения-хозяина [5].Такая высокая поведенческая пластичность делает их хорошими кандидатами для исследования молекулярных основ такого явления. Тем не менее, почти ничего не известно о физиологических и генетических механизмах, контролирующих полифенизм и индивидуальное поведение тлей [6], [7].

Было показано, что естественный полиморфизм в гене кормления ( для ), который кодирует cGMP-зависимую протеинкиназу (PKG), связан с поведенческой пластичностью у нескольких видов насекомых [8]. У плодовой мухи Drosophila melanogaster личинки и имаго фенотипа марсохода имеют большие движущиеся следы в присутствии пищи по сравнению с ситтерами [9], [10].Более высокие уровни для экспрессии и активности PKG наблюдаются в головах аллельных вариантов ровера [11]. Затем было высказано предположение, что ген для играет роль в поведенческой пластичности в ответ на голодание [12]. У медоносной пчелы Apis mellifera на более высокие уровни экспрессии гена для ( Amfor ) и активности PKG были обнаружены у собирателей по сравнению с медсестрами [13]. Последующее исследование показало пик экспрессии Amfor в период перехода от кормилицы к собирателю и предположило, что в нормальных условиях поведение медоносных пчел при поиске пищи, по крайней мере, частично связано с триггером эффекта Amfor [14].Таким образом, экспрессия Amfor была тесно связана с задачами, выполняемыми вне улья, и предполагала, что она влияет на разделение труда путем модуляции фототаксиса [15], [16]. О дифференциальной экспрессии для гомологов гена также сообщалось у других социальных насекомых, хотя изначально наблюдалась отрицательная корреляция между уровнем активности PKG и активностью кормления. У обыкновенной осы Vespula vulgaris , шмелей и некоторых красных муравьев-комбайнов из рода Pogonomyrmex , которые все демонстрируют прогрессирование рабочих задач в течение их жизни, известное как возрастной полиэтиизм, ниже для уровней мРНК. кормораздатчиков, чем рабочих гнезд [17] - [19].Тем не менее Ingram et al. [20] недавно выделили более сложный паттерн экспрессии гена для у муравьев-сборщиков муравьев: изменение экспрессии на в течение дня согласуется с характерным для конкретной задачи циркадным ритмом, наблюдаемым у этого вида. Подобное колебание уровня экспрессии на наблюдалось у медоносных пчел с течением времени [14]. Более точное и систематическое исследование экспрессии гена для в сочетании с тщательным анализом поведенческих черт, вероятно, является лучшим подходом к пониманию механизмов, с помощью которых для модулирует поведение насекомых.

Недавнее секвенирование генома гороховой тли Acyrthosiphon pisum и его последующая автоматическая аннотация [21] предоставили полезный инструмент для характеристики гена для у клональных видов, демонстрирующих высокую поведенческую пластичность. В этом исследовании мы сначала клонировали кДНК гороховой тли , питающейся , ортологом гена Apfor . Затем мы проанализировали паттерны их экспрессии на разных этапах партеногенетического развития, морфах и вариантах поведения.Мы также исследовали, могут ли условия окружающей среды (низкая и высокая плотность населения, определяющие доступность пищевых ресурсов) влиять на экспрессию Apfor . Наши эксперименты показали, что Apfor высоко экспрессируется на ключевых стадиях развития и у бескрылых взрослых особей, выращиваемых в условиях скученности. Активность фермента PKG, измеренная в поведенческих вариантах, подтверждает наблюдаемые вариации экспрессии Ap для . Затем мы предполагаем, что Apfor может вызвать переход от малоподвижного к исследовательскому поведению.Наши результаты закладывают основу для более детального анализа влияния Apfor на пластичность поведения гороховой тли.

Материалы и методы

Штамм тли

Клон YR2 гороховой тли Acyrthosiphon pisum был предоставлен Дени Тагу (INRA, Ренн, Франция). В природе он является местом обитания вторичного эндосимбионта Regiella Insecticola . Тлю выращивали в цветочном горшке диаметром 15 сантиметров, содержащем 3 растения фасоли Vicia fabae , при 18 ° C и цикле свет / темнота 16/8, который обеспечивает партеногенное размножение (первородящие самки).Параллельно выращивали тлю при низкой и высокой плотности населения.

Клонирование

кормов A. pisum ген

мРНК PolyA + экстрагировали из 100 мг целых гомогенизированных Acyrthosiphon pisum бескрылых живородящих взрослых самок с использованием набора для очистки микромРНК (GE Healthcare). Конкретные кДНК амплифицировали с использованием 0,5 мкг полиА + мРНК в соответствии с набором для амплификации кДНК BD Smart RACE с последующим протоколом ферментной системы BD Advantage ™ 2 PCR Enzyme System (BD Biosciences) со специфическими праймерами, созданными из последовательности EST, доступной в AphidBase ( www.aphidbase.com) и кодирует частичное для кДНК (смысловой праймер: GAGTGGAGGTGAGCAGAG, антисмысловой праймер: CACTTTTCCGGAGGTCATAG). Эти праймеры совпадают с областью первого тандемного цГМФ-связывающего мотива гена для . Амплифицированные фрагменты клонировали с помощью набора TA Cloning® (Invitrogen) с использованием вектора pCR®2.1 и трансформировали в электрокомпетентные клетки E. coli One shot® TOP10 (Invitrogen). Рекомбинантные плазмиды из положительных клонов экстрагировали, очищали и секвенировали в GATC Biotech (Констанц, Германия).Полученные последовательности были протестированы на гомологию с известными по генам с использованием базы данных NCBI. Затем были идентифицированы две последовательности, гомологичные для , и названы вариант 1 и вариант 2. Из этих двух последовательностей были сконструированы праймеры для амплификации соответствующих полноразмерных кДНК из свежевыделенных образцов мРНК полиА + (смысловой праймер мРНК варианта 1: ACTGTTGCTTCAGTCGCTGTTTACA, вариант 2 мРНК смысловой праймер: CAGCGTCTATCTACGTATGTGC, общий антисмысловой праймер: GTAAAATCGTTGAGGCGGACAA).Отсутствие для гомологичных генов у эндосимбионтов YR2 было подтверждено с помощью общедоступных аннотаций геномов первичного симбионта Buchnera aphidicola и вторичного симбионта Regiella инсектикола.

Коллекция вариантов поведения

вариантов поведения было получено при двух различных условиях плотности популяции. Бескрылые живородящие взрослые особи (VWL) были извлечены в условиях низкой плотности населения, обеспечивающих хорошее качество пищи и большое пространство для размножения самок.Для этого пять самок были перенесены в цветочный горшок, и их однодневные взрослые потомства, сосущие листья, были собраны в одно и то же время утром. Другие варианты поведения были получены при высокой плотности популяции, инициированной пятью самками, перенесенными на цветочный горшок и оставленными там, дав начало нескольким поколениям, пока не были достигнуты условия скопления. Затем сгенерированные крылатые тли (VW) были собраны в возрасте одного дня (низкая выживаемость без свежих растений). В то же время некоторые бескрылые взрослые особи тли покинули растения, начав ходить и исследовать среду обитания (названные взрослыми бескрылыми фуражирами VWLf), в то время как другие продолжали питаться стеблями или листьями (называемые бескрылыми оседлыми скученными взрослыми животными VWLc).VWLf и VWLc были собраны в одно и то же время примерно через 3 часа после того, как первые особи начали ходить по стенкам клетки, что может быть в любое время дня.

Количественные ПЦР-анализы в реальном времени

мРНК PolyA + экстрагировали, как описано выше, из 100 мг целых Acyrthosiphon pisum особей на различных стадиях развития: личинки 1-го возраста (L1) (около 300 насекомых), личинки 2-го возраста (L2) (около 250 насекомых), крылатые (L3W). ) и бескрылые (L3WL) личинки 3-го возраста (около 150 насекомых каждая), крылатые (L4W) и бескрылые (L4WL) личинки 4-го возраста (около 50 насекомых в каждой), крылатые (VW) и бескрылые живородящие взрослые особи (VWL) (около 40 насекомых). каждый).От L1 до L4 отбирали пробы через 2 дня после линьки, а взрослых особей собирали в возрасте 1 дня. Варианты поведения (около 40 насекомых каждого VW, VWL, VWLc и VWLf) отбирали в условиях, как описано выше. Эксперименты проводились на целых тлях, а не на головах тлей, поскольку выделение головок от L1 и L2 было трудным и трудоемким процессом.

кДНК транскрибировали с использованием обратной транскриптазы SuperScript ™ II (Invitrogen) в соответствии с инструкциями поставщика с использованием 1 мкг полиА + мРНК.Эффективность каждой реакции обратной транскрипции тестировали путем амплификации полученных кДНК с различными наборами праймеров, используемых в следующих реакциях кПЦР с использованием ДНК-полимеразы UptiTherm (Uptima). Реакции количественной ПЦР проводили для каждого образца кДНК с использованием qPCR MasterMix Plus для SYBR® Green I No Rox (Eurogentec, Бельгия) на приборе DNA Engine Opticon®2 (Bio-Rad) со следующими условиями количественной ПЦР: 50 ° C для 2 мин, 95 ° C в течение 7 минут, 40 × (95 ° C в течение 30 секунд, 60 ° C в течение 30 секунд, 72 ° C в течение 45 секунд) и специфические праймеры (таблица S1).

Внутренний фрагмент рибосомного белка Rpl7 из A. pisum (номер доступа в Genbank NM001135898) использовали в качестве контроля для нормализации для экспрессии (RPL7-2QPCR вперед: ACTGTTCAGATTGCGTCAGATC, RPL7-2QPCR, обратный: AGGTAGTCC). Все реакции проводили в трех экземплярах для каждой кДНК, полученной по меньшей мере из четырех независимых экстрактов мРНК. Количественную оценку относительных уровней мРНК рассчитывали методом ΔΔCt [22]. Среднее значение и стандартная ошибка были рассчитаны для каждого экспериментального условия.Значения, полученные для уровней экспрессии, были относительными, и их можно было сравнивать только в рамках каждого экспериментального цикла. Статистический анализ проводили с использованием однофакторного дисперсионного анализа с последующим PLSD Фишера (защищенное наименьшее значимое различие) для проверки значимых различий в экспрессии между стадиями развития или вариантами поведения.

Анализ активности ферментов PKG

Анализы активности фермента

PKG проводили с использованием набора для анализа циклической GMP-зависимой протеинкиназы (cGK) Cyclex от Cyclex Co, Ltd.Свежие целые тела и отрезанные головы из различных вариантов поведения по отдельности гомогенизировали на льду в предоставленном киназном буфере. Образцы центрифугировали в течение 5 минут и супернатанты определяли количественно на общее количество белка с использованием реагента для анализа белка Coo (Uptima) по методу Брэдфорда. Затем 5 мкг общих белков анализировали на активность фермента PKG со следующими контролями, чтобы гарантировать специфичность реакций PKG: холостой (полный реакционный буфер), положительный контроль (полный реакционный буфер с положительным контролем cGK) и отрицательный контроль (образцы в реакционном буфере без цГМФ или без АТФ и цГМФ, образцы в полном реакционном буфере с добавлением ингибитора протеинкиназы K-252a от Sigma).OD определяли количественно при двух длинах волн 450/540 нм на спектрофотометре Spectramax Plus 384 (Molecular Devices). Активность фермента PKG выражали как OD для 5 мкг общих белков. Среднее значение и стандартная ошибка были рассчитаны для каждого экспериментального условия. Статистический анализ проводился с использованием однофакторного дисперсионного анализа с последующим PLSD Фишера для проверки значимых различий между вариантами поведения.

Результаты

Ген кормления Acyrthosiphon pisum

Для изоляции А.pisum для кДНК, мы разработали праймеры из фрагмента A. pisum EST, доступного в базе данных Aphidbase 1.0, который показал однозначную гомологию с Drosophila melanogaster для гена . 3 'и 5' эксперименты RACE привели к клонированию двух полноразмерных последовательностей кДНК, которые мы назвали Apfor1 (номер доступа GeneBank JN812212) и Apfor2 (номер доступа GeneBank JN812213). Благодаря недавнему секвенированию генома гороховой тли нам удалось найти эти два полных A.pisum для кДНК на геномном каркасе (Scaffold409, номер доступа в GeneBank GL350029) и впоследствии было установлено, что они состоят из 16 экзонов, экзоны с 3 по 16 являются общими для Apfor1 и Apfor2 (рисунок 1). Полный размер геномной последовательности Apfor трудно определить из-за большого размера некоторых интронов (особенно интрона 3, покрывающего более 300 т.п.н.) и остаточных ошибок секвенирования. В соответствии с данными о последовательности генома анализ саузерн-блоттинга ясно показал, что только один ген, гомологичный для , присутствует в A.pisum (данные не показаны).

Рисунок 1. Структура транскриптов Apfor1 и Apfor2 .

Экзоны 3–16 идентичны, только экзоны 1 и 2 отличаются в результате альтернативного сплайсинга. Каркас 409, содержащий два транскрипта, представлен вверху. Экзоны обозначены серыми прямоугольниками, а интроны - пунктирными линиями. Белые треугольники указывают положение стартовых кодонов, черные треугольники указывают положение стоп-кодона.

https: // doi.org / 10.1371 / journal.pone.0065104.g001

На рисунке S1 показаны нуклеотидная и выведенная аминокислотная последовательности двух полных кДНК. Эти последовательности имеют длину 3420 и 3338 п.н. соответственно и содержат ORF 2331 п.н. для Apfor1 и 2112 п.о. для Apfor2 . Они различаются только своей 5'-областью (первые два экзона) и полностью перекрываются для следующих 2462 п.н. (Рисунок 1) в результате альтернативного сплайсинга. Экзоны 1 и 2 Apfor2 действительно расположены в интроне 2 гена Apfor , что позволяет предположить, что эти экзоны сплайсированы в варианте Apfor1 .Обе последовательности Apfor1 и Apfor2 примерно на 56% идентичны на уровне нуклеотидов и на 70% сходны на уровне аминокислот с последовательностью гена для D. melanogaster . Анализ двух выведенных аминокислотных последовательностей выявляет типичные структуры цГМФ-зависимой протеинкиназы, включая N-концевую область, содержащую регуляторный компартмент (домен димеризации с мотивом лейциновой молнии, сайты аутофосфорилирования и аутоингибиторный домен), два тандемных циклических нуклеотида. -связывающие домены и каталитический домен серин / треонинкиназы, как определено PROSITE на портале ресурсов SIB ExPASy Bioinformatics (http: // prosite.expasy.org). Несмотря на различия в 5'-области, оба транскрипта кодируют предположительно полные и активные белки PKG, что позволяет предположить, что они являются двумя функциональными альтернативными вариантами сплайсинга одного и того же гена.

Сравнительная экспрессия

Apfor в морфах и стадиях развития

Относительная численность транскриптов Ap для была определена среди крылатых (полученных при высокой плотности популяции) и бескрылых морфов (выращенных при низкой плотности популяции) на разных стадиях развития (от L1 до взрослой особи) с использованием количественных ПЦР-анализов в реальном времени.Первый набор праймеров, разработанный для потенциальной амплификации всех различных Ap для транскриптов (таблица S1), нацелился на консервативную область, перекрывающую экзоны 15 и 16 на 3'-конце киназного домена. Результаты показали, что Apfor аналогичным образом экспрессируется в крылатых и бескрылых морфах во время развития (односторонний ANOVA с последующими тестами PLSD Фишера, F = 1,67, P > 0,05) (рис. 2A). Тем не менее, заметное увеличение Ap для экспрессии может быть обнаружено для стадий L1, L2 и L4W.

Рисунок 2. Относительная экспрессия Apfor , Apfor1 и Apfor2 на разных стадиях развития гороховой тли.

Количественная ОТ-ПЦР была проведена с использованием целых тел крылатых и бескрылых стадий развития личинок и взрослых особей. (A), Глобальное относительное выражение Ap для . (B), относительное выражение Apfor1 . (C), относительная экспрессия Apfor2 . LI, личинки 1-го возраста; L2, личинки 2-го возраста; L3WL, бескрылые личинки 3-го возраста; L3W крылатые личинки 3-го возраста; L4WL, личинки 4-го возраста; L4W - крылатые личинки 4-го возраста; VWL, бескрылые живородящие взрослые особи, VW, крылатые живородящие взрослые особи.Относительная экспрессия нормализована к стадии L1. Столбики ошибок представляют собой стандартные ошибки, преобразованные в ту же произвольную шкалу, что и средние значения. Односторонний дисперсионный анализ с последующим тестом PLSD Фишера показывает статистически значимые различия между группами, обозначенными разными буквами ( P <0,05 или P <0,01).

https://doi.org/10.1371/journal.pone.0065104.g002

Два других набора праймеров, нацеленных на второй экзон каждого транскрипта, были разработаны для специфической амплификации каждого из двух транскриптов Apfor (Таблица S1) .Экспрессия Apfor1 значительно выше на стадиях L2 и L4W, чем на других стадиях (F = 5,12; P <0,001 и P <0,05 соответственно) (Рисунок 2B). Аналогичная разница в уровнях экспрессии наблюдается для Apfor2 (F = 4,06; P <0,05 для стадий L2 и L4W) (рис. 2C). Таким образом, паттерны экспрессии двух транскриптов примерно одинаковы во время развития гороховой тли.

Нозерн-блот-эксперименты с использованием фрагмента, перекрывающего конец первого и половины второго cGMP-связывающих доменов в качестве специфического зонда, показали присутствие по крайней мере двух дополнительных транскриптов Apfor (рисунок S2), которые мы не смогли клонировать, вероятно, из-за их слабое выражение.

Сравнительная экспрессия

Apfor среди вариантов поведения взрослых особей гороховой тли

В условиях скученности у бескрылых взрослых наблюдаются различные варианты поведения, помимо типичного образования крылатых морфов, способных распространяться на большие расстояния [1], [5]. Действительно, некоторые бескрылые тли продолжают питаться соком флоэмы под листьями или стеблями (варианты VWLc), в то время как другие покидают растение, ходят и кормятся в окружающей среде, чтобы найти лучшие условия для питания и производства потомства (варианты VWLf).Таким образом, мы проанализировали уровень транскриптов Ap для в четырех категориях поведенческих взрослых вариантов, три из которых выращивались в условиях высокой плотности популяции (крылатые взрослые особи VW, бескрылые оседлые густые взрослые особи VWLc и взрослые бескрылые собиратели VWLf) и один, выращенный в условиях низкой плотности населения (бескрылые малоподвижный взрослый VWL) (Рисунок 3). Экспрессия транскрипта Apfor1 значительно выше в вариантах VWLc по сравнению с другими вариантами (однофакторный дисперсионный анализ с последующим тестом PLSD Фишера; F = 8,71, P <0,001) (рис. 3A). Apfor2 транскрипты также значительно более выражены в варианте VWLc (F = 4,08, P <0,05), но мы наблюдаем ту же тенденцию в варианте VWLf. Для обоих вариантов наблюдается более высокое значение стандартной ошибки (рис. 3В). Эти результаты подтверждают наши предыдущие наблюдения (рис. 2), что не наблюдается значительных различий в экспрессии Ap для между VW, выращенным при высокой плотности популяции, и VWL, выращенным при низкой плотности популяции. Таким образом, высокий уровень экспрессии гена у гороховой тли , по-видимому, связан с исследовательским поведением из-за тесноты, а не с морфологическими вариантами.

Рисунок 3. Относительная экспрессия Apfor1 и Apfor2 среди вариантов поведения взрослых гороховых тлей.

(A), относительное выражение Apfor1 . (B), относительное выражение Apfor2 . VW, крылатые живородящие взрослые особи, выращенные при высокой плотности населения; VWL, бескрылые живородящие взрослые особи, выращиваемые при низкой плотности населения; VWLc, бескрылые живородящие взрослые особи, выращиваемые при высокой плотности населения; VWLf, бескрылые живородящие взрослые особи-фуражиры, выращиваемые при высокой плотности населения.Столбики ошибок представляют собой стандартные ошибки, преобразованные в ту же произвольную шкалу, что и средние значения. Относительное выражение нормализовано к VW. Был проведен односторонний дисперсионный анализ с последующим PLSD-тестом Фишера. Статистически значимые различия между группами обозначены разными буквами ( P <0,01 в случае Apfor1 и P <0,05 в случае Apfor2 ).

https://doi.org/10.1371/journal.pone.0065104.g003

Активность фермента PKG среди вариантов поведения взрослых особей гороховой тли

Активности фермента

PKG, которые представляют собой, по крайней мере, объединенные активности двух вариантов Apfor , были сравнительно измерены в различных вариантах поведения для всего тела или головы.На рис. 4 показана активность фермента PKG во всем теле и в головах всех вариантов поведения, подтверждая, что транскрипты Apfor продуцируют функциональные белки PKG. Модель активности фермента PKG примерно одинакова для всего тела или головы, что указывает на то, что измерения на всем теле, безусловно, представляют то, что происходит в головах. Паттерн активности фермента PKG, наблюдаемый в головах среди поведенческих вариантов, коррелирует с паттерном экспрессии Apfor (фиг. 3) и, таким образом, с вероятным влиянием PKG на поведение тли.Действительно, вариант VWLc демонстрирует значительно более высокую ферментативную активность PKG во всем теле, как и в головах (F = 3,116, P <0,05).

Рисунок 4. Активность фермента PKG среди вариантов поведения взрослых гороховых тлей.

(A) Активность фермента PKG во всем организме. (B) Активность фермента PKG в головах. Активность фермента PKG выражается как OD для 5 мкг общих белков для каждого варианта поведения. Планки погрешностей представляют собой стандартные ошибки, преобразованные в ту же произвольную шкалу, что и средние значения.Был проведен односторонний дисперсионный анализ с последующим PLSD-тестом Фишера. Статистически значимые различия между группами обозначены разными буквами ( P <0,05).

https://doi.org/10.1371/journal.pone.0065104.g004

Обсуждение

Наши результаты подтверждают, что кормления , важный ген, связанный с поведенческой пластичностью насекомых, сохраняется у Hemiptera. Мы действительно сообщаем о клонировании и анализе транскриптов этого гена у гороховой тли Acyrthosiphon pisum , особенно интересного вида с точки зрения его способности полифенизма в сочетании с поведенческой пластичностью, позволяющей быстро адаптироваться к неблагоприятным условиям окружающей среды, таким как перенаселенность или присутствие враги.Эта краткосрочная адаптивная реакция наделяет виды тлей их замечательным инвазионным потенциалом, что делает их эффективными насекомыми-вредителями.

Интересно, что экспрессия гена кормящейся гороховой тли кажется столь же сложной, как описано в D. melanogaster [23] или Cænorhabditis elegans [24] с множественными альтернативными транскриптами сплайсинга. Функциональная значимость двух идентифицированных транскриптов не была определена, но они представляют собой полноразмерные варианты, которые кодируют два предполагаемых функциональных белка.Эти транскрипты продуцируются одним геном, как определено в эксперименте по Саузерн-блоттингу (данные не показаны). Анализ последовательностей генома гороховой тли обнаруживает второй ген, кодирующий cGMP-зависимую протеинкиназу (GeneBank, номер доступа XM 001947008), весьма вероятно, ортолог гена dg1 из D. melanogaster . Эти два гена тли достаточно разошлись (41% сходства), чтобы не подвергаться перекрестной гибридизации с использованием классических методов саузерн-блоттинга. Таким образом, гороховая тля кажется так же генетически оснащенной, как и D.melanogaster или пчела, чтобы настроить пластичность поведения.

На первом этапе мы проверили, могут ли морфологическое состояние (бескрылые или крылатые морфы) и различные стадии развития живородящих партеногенетических гороховых тлей быть связаны с дифференциальной экспрессией Apfor . Паттерны экспрессии транскриптов Apfor1 и Apfor2 примерно схожи, и не обнаружено значительных различий между бескрылыми и крылатыми морфами на любой стадии развития.Напротив, мы наблюдаем, что личиночные стадии 2-го возраста и крылатые 4-й возраст показывают значительно более высокую экспрессию двух транскриптов Apfor , чем другие стадии. Ранее было показано, что стадия L2 имеет решающее значение для формирования крыльев. Действительно, Исикава и его коллеги [25] продемонстрировали, что все личинки первого возраста (выращенные в условиях низкой или высокой плотности) обладают зачатками крыльев, которые дегенерируют во время личинок второго возраста только в бескрылых формах. У крылатых форм зачатки крыльев развиваются и становятся толстыми.Таким же образом эти авторы показали, что во время личиночной стадии 4-го возраста переход внутренних структур в зачатках крыльев драматичен: мышечные клетки полностью пролиферируют и сливаются в синцитиальные мышечные клетки. Apfor , таким образом, сильно экспрессируется на ключевых этапах развития личинок, участвующих в формировании крыльев и, следовательно, в летной способности гороховой тли.

На втором этапе мы проверили экспрессию Apfor среди вариантов поведения живородящих партеногенетических взрослых особей, которые производятся в условиях низкой плотности популяции или в условиях тесноты.Неожиданно, варианты поведения, имеющие значительно более высокую экспрессию Apfor , представляют собой бескрылые тли, питающиеся соком флоэмы листьев или стеблей. Собиратели, убегающие в поисках свежих ресурсов, представляют лишь небольшое увеличение - Apfor2 транскриптов. Поскольку наши результаты были получены с использованием всего тела тли, а не только головы, которая является центром управления поведением, нельзя сделать вывод о прямой корреляции между Ap для и поведением тли. В самом деле, для гена также было показано у Drosophila, чтобы участвовать в др. Физиологических процессах, таких как образование кристаллических клеток [26] или модуляция сердечного ритма у Drosophila [27].Таким образом, мы провели измерения активности фермента PKG в организме в целом и в головах с различными вариантами поведения. Результаты совпадают с результатами, наблюдаемыми для экспрессии Ap for , со значительно более высокой активностью у тлей VWLc. Это подтверждает гипотезу о существовании корреляции между Ap для экспрессии и поведением тли. Взятые вместе, наши результаты показывают, что Apfor может вызывать у некоторых бескрылых взрослых особей пищевое поведение в условиях скопления людей, действуя как стимулирующий сигнал для поиска лучших экологических ниш за короткое время.У собирателей будет более слабый Ap для транскрипта и уровень активности PKG, возможно, как остаточная экспрессия после поведенческого переключения, инициированного Apfor . Учитывая, что для перехода от малоподвижного к рассеянному поведению, безусловно, требуется стимул, ген для является многообещающим кандидатом на выполнение этой роли. В настоящее время необходимы дополнительные поведенческие эксперименты, чтобы однозначно определить, являются ли бескрылые оседлые взрослые особи, выращенные в условиях скопления людей и демонстрирующие повышенный уровень Ap для , тем, кто впоследствии питается своей средой.Насколько нам известно, подробное поведение взрослых бескрылых тлей еще не описано. Кроме того, еще предстоит определить точную природу стимула и его молекулярные мишени.

У пчелы A. mellifera появление пика экспрессии Amfor , а не медленно приближающийся и непрерывный высокий уровень экспрессии, предполагает, что переход от медсестер к собирателям вне улья запускается Amfor [ 14]. Таким же образом в комбайне муравей P.occidentalis ежедневные колебания происходят в выражении для ортолога Pofor . Пик уровня мРНК наблюдается у собирателей в полдень [19], в то время как рабочие гнезда показывают более низкие уровни мРНК Pofor в течение дня и аналогичные или более высокие уровни в поздние вечерние и ранние утренние часы. Интересно, что у родственного муравья-комбайна P. barbatus , Инграм и его коллеги [17] показали более низкую экспрессию Pbfor у собирателей, чем у рабочих, но исследование ограничивалось сбором рабочих в одно время дня ( как мы это сделали с гороховой тлей).Поскольку отобранные рабочие были собраны в поле ранним утром, нельзя исключить, что экспрессия Pbfor колеблется в дневное время по той же схеме, что и Pofor . В лабораторных условиях плотность популяции гороховой тли должна была быть очень высокой со сливными взрослыми особями, чтобы одновременно производить крылатых морфов и бескрылых вариантов поведения. Как следствие, было очень трудно собрать синхронных людей для всех реплик кПЦР, что, таким образом, могло бы объяснить высокий диапазон стандартных ошибок для наших экспериментов (рис. 3).Как и у муравьев-комбайнов, ген Apfor может сильно экспрессироваться в определенное время дня или в жизненном цикле только части бескрылых особей гороховой тли в ответ на внешний стимул, запускающий их пищевое поведение. Необходимы дополнительные эксперименты, чтобы определить время экспрессии Apfor у бескрылой гороховой тли в условиях скопления людей и выяснить, все ли особи или только некоторые из них по-разному экспрессируют Apfor , чтобы установить конкретную взаимосвязь между этим геном и пластичностью поведения. .Как и у других видов, природа взаимодействующих стимулов и их молекулярные мишени еще предстоит определить. У нематод запахи и феромоны действуют, стимулируя и регулируя экспрессию для ортолога Egl-4 [29], а у нематоды Pristionchus pacificus , Ppa-egl-4 непосредственно участвует в притяжении к феромон, испускаемый насекомым-хозяином [30]. Может ли сигнальный феромон гороховой тли, который опосредует образование морф крылатого рассеивания, также регулировать экспрессию Apfor ? В этом случае новая роль в химиопривлечении или обонянии может быть отведена вместо у насекомых, равно как и его роли у нематод.

Как и у социальных насекомых, чье рабочее поведение, по-видимому, связано с регуляцией экспрессии гена для , колебания экспрессии Apfor у гороховой тли, по-видимому, связаны с пластичностью пищевого поведения. Это установило бы связь между геном для и пластичностью пищевого поведения для всего класса насекомых. У партеногенетических насекомых, таких как тли, среди которых некоторые виды размножаются только как клональные формы, наличие таких генов, способствующих адаптации к стрессам окружающей среды, очень важно для компенсации отсутствия генетической изменчивости, вызванной спариванием.Эти гены могут позволить тле уменьшить задержку реакции на вредные биотические (низкое качество пищевых ресурсов, присутствие естественных врагов) и абиотические факторы (загрязнители, климат) и развить быстрые адаптивные реакции на сигналы окружающей среды, создавая наиболее адаптированные фенотипы. Наконец, универсальность , собирающего пищу , как молекулярного модулятора поведения, кажется, усиливается.

Дополнительная информация

Рисунок S1.

Нуклеотидные последовательности, выведенные последовательности белков и структура двух вариантов кДНК Apfor . Два варианта отмечены v1 ( Apfor1 ) и v2 ( Apfor2 ). Характерная аминокислотная подпись мотива лейциновой молнии внутри домена димеризации обведена желтым. Ключевой мотив домена автоингибирования обведен зеленым. Пределы экзонов обозначены вертикальными синими полосами. Справа пронумерованы нуклеотиды и аминокислоты.

https://doi.org/10.1371/journal.pone.0065104.s001

(PDF)

Рисунок S2.

Нозерн-блот-анализ экспрессии Ap для . Использовали 6 мкг полиА + мРНК бескрылых взрослых особей. Зонд 406 п.н., перекрывающий два cGMP-связывающих домена Apfor , был помечен дигоксигенином с использованием набора для синтеза зонда PCR DIG от Roche Diagnostics (Германия). Фрагмент RPL7 использовали в качестве контроля.

https://doi.org/10.1371/journal.pone.0065104.s002

(PDF)

Благодарности

Мы благодарим Дениса Тагу, Жан-Кристофа Симона и Янника Аутремана за полезные обсуждения и Мэрилен Пуари за комментарии к рукописи.

Вклад авторов

Задумал и спроектировал эксперименты: ST MA AR. Проведены эксперименты: СТ ЛА. Проанализированы данные: ST MA. Предоставленные реагенты / материалы / инструменты анализа: ST LA MA. Написал статью: ST MA.

Ссылки

  1. 1. Sutherland ORW (1969) Роль скученности в образовании крыловых форм двумя штаммами гороховой тли Acyrthosiphon pisum . J Insect Physiol 15: 1385–1410.
  2. 2. Müller CB, Williams IS, Hardie J (2001) Роль питания, скученности и межвидовых взаимодействий в развитии крылатых тлей.Ecol Entomol 26: 330–340.
  3. 3. Табадкани С.М., Ахсаи С.М., Хоссейнинавех В., Нозари Дж. (2012) Быстрая ходьба, чтобы восстановить потерю энергии! Пищевой стресс приводит к смене репродуктивной фазы и фазы расселения у бескрылой гороховой тли. Physiol Behav. В прессе. DOI: https: //doi.org/10.1016/j.physbeh.2012.12.004
  4. 4. Дилл Л. М., Фрейзер А. Х., Ройтберг Б. Д. (1990) Экономическое поведение при побеге у гороховой тли, Acyrthosiphon pisum . Oecologia 83: 473–478.
  5. 5.Montgomery ME, Nault LR (1977) Сравнительный ответ тлей на феромон тревоги, (E) -бета-фарнезен. Ent Exp Appl 22: 236–242.
  6. 6. Huybrechts J, Bonhomme J, Minoli S, Prunier-Leterme N, Dombrovsky A и др. (2010) Нейропептиды и предшественники нейрогормонов тля, Acyrthosiphon pisum . Насекомое Mol Biol 19: 87–95.
  7. 7. Саймон Дж. К., Пфрендер Э. М., Толлриан Р., Тагу Д., Колборн К. Дж. (2011) Геномика экологически индуцированных фенотипов у 2 чрезвычайно пластичных членистоногих.J Hered 102: 512–525.
  8. 8. Reaume CJ, Sokolowski MB (2011) Сохранение функции генов в поведении. Фил Транс Р. Соц. 366: 2100–2110.
  9. 9. Соколовский М.Б. (1980) Стратегии поиска пищи Drosophila melanogaster : хромосомный анализ. Behav Genet 10: 291–309.
  10. 10. Pereira HS, Sokolowski MB (1993) Мутации гена личиночного кормодобывания влияют на двигательное поведение взрослых особей после кормления у дрозофилы melanogaster. Proc Natl Acad Sci USA 90: 5044–5046.
  11. 11. Осборн К., Робишон А., Берджесс Э., Бутланд С., Шоу Р.А. и др. (1997) Природный полиморфизм поведения, обусловленный цГМФ-зависимой протеинкиназой Drosophila . Наука 277: 834–836.
  12. 12. Kaun KR, Riedj CAL, Chakaborty-Chatterjee M, Belay AT, Douglas SJ, et al. (2007) Естественные вариации в потреблении пищи, опосредованные cGMP-зависимой протеинкиназой. J Exp Biol 210: 3547–3558.
  13. 13. Бен-Шахар Ю., Робишон А., Соколовски М.Б., Робинсон Г.Е. (2002) Влияние действия гена на поведение в разных временных масштабах.Наука 296: 741–744.
  14. 14. Heylen K, Gobin B, Billen J, Hu TT, Arckens L, et al. (2008) Экспрессия Amfor в мозге медоносной пчелы: пусковой механизм перехода медсестра-собиратель. J Insect Physiol 54: 1400–1403.
  15. 15. Бен-Шахар Ю., Леунг Х.Т., Пак В.Л., Соколовски М.Б., Робинсон Г.Е. (2003) cGMP-зависимые изменения фототаксиса: возможная роль гена кормодобывания в разделении труда медоносных пчел. J Exp Biol 206: 2507–2515.
  16. 16.Бен-Шахар Ю. (2005) Ген кормления , пластичность поведения и разделение труда пчел. C Comp Physiol A 191: 987–994.
  17. 17. Инграм К.К., Офнер П., Гордон Д.М. (2005) Специфическая для задачи экспрессия гена кормления у муравьев-собирателей. Мол Экол 14: 813–818.
  18. 18. Лукас С, Соколовски МБ (2009) Молекулярная основа изменений поведенческого состояния в социальном поведении муравьев. Proc Natl Acad Sci USA 106: 6351–6356.
  19. 19.Tobback J, Mommaerts V, Vandermissen HP, Smagghe G, Huybrechts R (2011) , зависящие от возраста и задачи, обеспечивающие экспрессию гена у шмеля Bombus terrestris . Arch Insect Biochem Physiol 76: 30–42.
  20. 20. Инграм К.К., Клеман Л., Петеру С. (2011) Дифференциальная регуляция гена кормления , связанного с заданным поведением у муравьев-сборщиков. BMC Ecol 11: 19.
  21. 21. The International Aphid Genomics Consortium (2010) Последовательность генома гороховой тли Acyrthosiphon pisum .PloS Biol 8: e1000313
  22. 22. Ливак К.Дж., Шмитген Т.Д. (2001) Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2 (-Delta Delta C (T)). Методы 25: 402–408.
  23. 23. Kalderon D, Rubin GM (1989) гены cGMP-зависимых протеинкиназ в Drosophila . J Biol Biochem 264: 10738–10748.
  24. 24. Fujiwara M, Sengupta P, McIntire SL (2002) Регулирование размера тела и поведенческого состояния C.elegans сенсорным восприятием и EGL-4 cGMP-зависимой протеинкиназой. Нейрон 36: 1091–1110.
  25. 25. Исикава А., Хинго С., Миура Т. (2008) Морфологическое и гистологическое исследование образования полифенических крыльев у гороховой тли Acyrthosiphon pisum (Hemiptera, Hexapoda). Зооморфология 127: 121–133.
  26. 26. Милчановски А.Б., Хенкениус А.Л., Нараянан М., Хартенштейн В., Банерджи У. (2004) Идентификация и характеристика генов, участвующих в формировании эмбриональных кристаллических клеток во время гематопоэза дрозофилы.Генетика 168: 325–339.
  27. 27. Johnson E, Sherry T, Ringo J, Dowse H (2002) Модуляция кардиостимулятора Drosophila: клеточные механизмы. J Comp Physiol B 172: 227–236.
  28. 28. Брандл С., Дэвис Г.К., Бриссон Дж. А., Стерн Д.Л. (2006) Диморфизм крыльев у тлей. Наследственность 97: 192–199.
  29. 29. L'Etoile ND, Coburn CN, Eastham J, Kistler A, Gallegos G и др. (2002) Циклическая GMP-зависимая протеинкиназа EGL-4 регулирует обонятельную адаптацию у C.elegans . Нейрон 36: 1079–1089.
  30. 30. Hong RL, Witte H, Sommer RJ (2008) Природные вариации в привлечении феромонов насекомых Pristionchus pacificus связаны с протеинкиназой EGL-4. Proc Natl Acad Sci USA 105: 7779–7784.

Ресвератрол: от улучшенного биосинтеза и биодоступности до хронических заболеваний с множественной направленностью

Основные моменты

Ресвератрол - это полифенольное соединение с рядом фармакологических свойств.

Микроорганизмы и генетические манипуляции помогают бороться с его неблагоприятным синтезом.

Его плохая фармакокинетика решается с помощью биоусилителей и нано-составов.

Ресвератрол служит терапевтическим средством при хронических заболеваниях с множественной направленностью.

Имеет потенциал для лечения диабета, сердечно-сосудистых и неврологических заболеваний.

Реферат

Ресвератрол, фитоалексин с широким спектром фармакологических свойств, синтезируется растениями в ответ на стресс, травму, инфекцию или УФ-излучение.Поскольку это вторичный метаболит со многими способствующими укреплению здоровья свойствами, были всесторонне изучены различные методы с использованием микроорганизмов и генетических манипуляций с различными синтетическими ферментами для увеличения его производства. Его быстрый метаболизм и низкая биодоступность решаются за счет использования биоусилителей и нано-составов. Этот флавоноид широко исследуется из-за его фармакологических свойств, таких как антиоксидантное, противовоспалительное и иммуномодулирующее действие. Знание этих свойств ресвератрола привело к тщательным исследованиям его влияния на диабет, нейродегенеративные заболевания, рак, старение, ожирение и сердечно-сосудистые заболевания.На молекулярном уровне он нацелен на сиртуин, аденозинмонофосфаткиназу, ядерный фактор-κB, воспалительные цитокины, антиоксидантные ферменты, а также на клеточные процессы, такие как ангиогенез, апоптоз, митохондриальный биогенез, глюконеогенез и метаболизм липидов. В этом обзоре обсуждаются свойства ресвератрола и различные подходы к решению проблемы неблагоприятного синтеза и фармакокинетики этого стильбена. Доклинические оценки ресвератрола при сахарном диабете, сердечно-сосудистых и неврологических заболеваниях подробно обсуждаются, и первостепенное значение придается основным путям его терапевтического действия.После доклинических исследований клинические испытания того же самого показывают эффективность ресвератрола в эффективном лечении этих заболеваний. Этот обзор дает подробное представление о значении ресвератрола от диетического компонента до терапевтического агента.

Ключевые слова

Ресвератрол

Фармакокинетика

Биосинтез

Диабет

Сердечно-сосудистые заболевания

Неврологические заболевания

Рекомендуемые статьиЦитирующие статьи (0)

Просмотреть аннотацию

© 2018 Авторы.Опубликовано Elsevier Masson SAS.

Рекомендуемые статьи

Цитирующие статьи

с 9.00 до 12.30 - Английский перевод - Linguee

Por medios electrnicos se присоединяется к pelculas coreanas y extranjeras y a obras literarias, as

[...]

como a materiales docentes

[...] сказки como Английский Выучите в g , От A до Z y que [Компьютерное обучение,..]

proporcionan mucha informacin interna y externa.

daccess-ods.un.org

Эти электронные носители содержат корейские и зарубежные художественные фильмы и другие литературные произведения, а также

[...]

учебных материалов, например

[...] Английский Le ar ning, От А до Я и C компьютер Learni ng , давая c hi ldren [...]

доступ к разнообразной внутренней и внешней информации.

daccess-ods.un.org

Presentacin a la prensa de las

[...] Exposici на e s От I до J . U n home [...]

от Isabel Coixet и John Berger, y de Proyecto para

[...]

присин абандонада де Мара Джесс Гонслез и Патрисия Гмез.

artssantamonica.com

Представление для прессы

[...] экспонат io нс От I до J. Дань [...]

Джону Бергеру от Изабель Койшет и проект

[...]

Заброшенная тюрьма Джесса Гонслеса и Патрисии Гомес.

artssantamonica.com

Уменьшить детскую смертность li t y от 1 4 7 до 1 материнская 0 li t y от 5 0 6 до 3 5 90tim.ch

Снижение детской смертности со 147 до 103 на 1000, материнской смертности с 506 до 354 на 100000

cetim.ch

Индикатор нормальной температуры или высоты со светодиодной подсветкой: verde = todo "OK",

[...] [...] rojo = alarma de fiebre (часть 37,6C) precisionitud de medicin en el odo 0,2C de 35,5C и среднеквадратичная (выше 37,6C) точность измерения в ухе 0 , 2 C от 3 5 .5 C до 4 2 C

wellnessproducts.ch

Отображение нормальной или повышенной температуры с помощью цветных светодиодов: зеленый = все в порядке, красный = тревога по температуре (выше 37,6 ° C), точность измерения в ухе 0,2 ° C от 35,5 ° C до 42 ° C

wellnessproducts.ch

Презентация

[...] la prensa de las Exposici на e s От I до J . U nhomenaje de Isabel Coixet [...]

a John Berger, y de Proyecto para

[...]

prisi? N Abandonada de Mar? A Jes? S Gonz? Lez y Patricia G? Mez.

artsantamonica.cat

Презентация для прессы ex hibit ion s От I до J. A T ribute [...]

Джону Бергеру от Изабель Койшет и проект

[...]

Заброшенная тюрьма от M? Джес Гонсалес и Патрисия Гомес.

artsantamonica.cat

от 7 до 1 4 d as.

ecotrekperu.com

от 7 до 14 da ys .

ecotrekperu.com

Решение Совета МБП на его пятьдесят пятой сессии (январь 2007 г.) предложить 34-й Генеральной конференции.

[...]

, что 48-я сессия ICE будет

[...] организовано в Ge ne v a от 25 до 2 8 N ноябрь 2008 [...

на тему: «Инклюзивное образование:

[...]

путь в будущее »; рекомендовать государствам-членам организовать подготовительные встречи на региональном уровне во всех регионах; и просить назначенного директора, в сотрудничестве с Рабочей группой Совета и Сектора образования, инициировать ICE подготовительные работы и отчет Совету на его 56-й сессии.

unesdoc.unesco.org

Решение Совета МБП на его пятьдесят пятой сессии (январь 2007 г.) предложить 34-й Генеральной конференции провести 48-ю сессию МКО в

г. [...]

Женева с 25 по 28 ноября 2008 г. по автостраде

[...] тема: "Inclus iv e Образование: Th e путь [...]

будущее "; рекомендовать государствам-членам

[...]

организуют подготовительные встречи на региональном уровне во всех регионах; и просить назначенного директора в сотрудничестве с Рабочей группой Совета и Сектора образования начать подготовительные работы ICE и отчитаться перед Советом на его 56-й сессии.

unesdoc.unesco.org

2: проблема с валорой в лал n e a от o до

infocom21.net

2: проблема со значением в t he From or T o line

infocom21.net

Анализ национальных отчетов, представленных St на e s от 2 00 2 до 2 , который включен в предыдущую документацию Reunin Bienal de los Estados.

daccess-ods.un.org

Результаты анализа были представлены в проекте отчета, озаглавленного «Осуществление Программы действий Организации Объединенных Наций по стрелковому оружию и легким вооружениям: анализ национальных докладов, представленных государствами с 2002 по 2008 годы», который был включен в справочную документацию для Двухгодичное собрание.

daccess-ods.un.org

Упадок и

[...] Падение T ru t h от 9 /1 1 до K a..]

Press, 2006) las siguientes palabras de un asesor del presnte

[...]

Джордж Буш (que podra haber sido Karl Rove, Cj.): "El estudio juicioso de la realidad ya no es la forma en la que funciona el mundo.

galeriampa.com

Упадок и падение

[...] Истины от 9/ 11 до Ka tr ina, Penguin Press, [...]

2006, следующие слова советника президента

[...]

Джордж Буш (он мог быть Карл Роув, Сиджей): «Разумное исследование реальности больше не состоит в том, как устроен мир.

galeriampa.com

с. 5-6. Согласно UNICEF

[...]

Годовой отчет за 2006 год, Страновые программы сотрудничества ЮНИСЕФ

[...] в Indon es ​​ i a от 2 00 6 до 2 0 0...]

до 26,5 миллиона долларов.

daccess-ods.un.org

с. 5-6. Согласно UNICEF

[...]

Годовой отчет за 2006 год, Страновые программы ЮНИСЕФ

[...] Сотрудничество в Indone si a от 2 00 6 до 2010 будет [...]

составляет 26,5 миллиона долларов.

daccess-ods.un.org

Обычный и

[...] adventure t ou r s от L im a до L i ma д . Начиная с 7 до 1 4 d as.

ecotrekperu.com

Сайты Principaux et aventures orig в элей, de Lima Lim a, de 7 1 4 журнала .

ecotrekperu.com

В частности, эволюция человеческих ресурсов учитывает увеличение оперативного кредита для программы, и incr ea s e от 19 до 2 1 o ffic ia l s от 2 00 7 до 9068

eur-lex.europa.eu

В частности, эволюция человеческих ресурсов учитывает увеличение оперативного кредита для программы и увеличение с 19 до 21 сотрудника с 2007 по 2013 год.

eur-lex.europa.eu

Opcin agregada a los

[...] viejos mensajes inmediatos de la clase p o r от / до e n v ez por de la fecha.

koinonia.cnc.edu

Добавлена ​​возможность сортировки старых мгновенных сообщений по от / до, а не по дате.

koinonia.cnc.edu

В период между обретением независимости и 1985 годом количество медицинских пунктов в стране увеличилось с до e d с 3 2 6 до 1 , 19 5.36 Однако во время гражданской войны многие из этих объектов были разрушены или разграблены.

daccess-ods.un.org

В период между обретением независимости и 1985 годом количество медицинских пунктов в стране увеличилось с 326 до 1195.36 Однако во время гражданской войны многие из этих медицинских учреждений подверглись нападениям и были разрушены или разграблены.

daccess-ods.un.org

Los valores допустимые значения son numricos (ejemplo sport = 80 para HTTP), rangos (ejemplo s po r t от 20 до 5 o спорт в 20..50 para cualquier nmero de Puerto entre 20 y 50) o alias Definidos por el sistema operativo (ejemplo sport = ftp, que es эквивалент a 21).

tamos.co.nz

Допустимые значения - числа (например, sport = 80 для HTTP), диапазоны (например, sport от 20 до 50 или sport в 20..50 для любого номера порта от 20 до 50) или псевдонимы, определенные вашей операционной системой (например, sport = ftp , что эквивалентно 21).

tamos.co.nz

Климат от субтропического влажного до тропического влажного с

[...] количество осадков побежало gi n g от 1 5 0 0 до год.

obreal.org

Климат от субтропического влажного до тропического влажного с

[...] осадки ra ng ing от 1 50 0 до 7 00 0 мм / ye ar.

obreal.org

Su obra abarca desde publicaciones como Terminal Zone, R.O.O.M (1987–1989), pasando por Program (Hamburgo, 1999), un

[...]

proyecto de arte pblico y TV, a proyectos de

[...] Exposicin co m o From / To ( W it te de With, [...]

1999), год от 1999, дом 0, концепция

[...]

из программы Knstlerhaus Stuttgart, como Director artstico de dicha institucin.

web.ftapies.com

Его работы варьируются от журналов Terminal Zone, R.O.O.M (1987-89) до Program (Гамбург, 1999), паблик-арт /

[...]

телепроект, к выставочным проектам такие

[...] как From / T o (Wi tte de Wit h, 19 99 ) и [...]

с 1999 г., дом.0, концепция программирования

[...]

для Knstlerhaus Stuttgart, где он является художественным руководителем.

web.ftapies.com

Срок действия правовой базы ru n s от 0 1 /0 1/ 20 0 8 3 1 /1 2/2013.

eur-lex.europa.eu

Срок действия правовой базы - с 01.01.2008 по 31.12.2013.

eur-lex.europa.eu

ACTIVIDAD RELACIONADA с

[...] la Expo ci n ОТ I ДО J . C onversacin entre John Berger e Isabel Coixet, y Presentacin de las ediciones catalana (Edicions de 1984) и castellana (Alfaguara ) d e A X , d e Джон Бергер.

artssantamonica.com

ДЕЯТЕЛЬНОСТЬ, СВЯЗАННАЯ С

[...] выставка ОТ I ДО J. Разговор между Джоном Бергером и Изабель Койшет и презентация каталонского ( Ed icio ns de 19 84) и d кастильские издания ( Alfaguara ) из романа Джона Бера ge r Fro m от A до X.

artssantamonica.com

Es en este context q u e от D e fen c e до lopment procura hacer una contribucin concreta y important.

ghri.gc.ca

Именно в этом контексте «От обороны к развитию» стремится внести реальный и живой вклад.

ghri.gc.ca

La expre si n от s t ab l e до t 9068 trace 9068 9068 9068 9068 [...]

libremente como del Agricultor al consumidor.

europarl.europa.eu

От sta bl e до t ab le 'переводится свободно [...]

на голландский, как от фермера к тарелке ».

europarl.europa.eu

от y до r e co nocen el patrn [...]

en comentarios, por lo tanto ten en cuenta aquellos comentarios que Detendran el include inadvertidamente.

pr.iseit.net

от nd до reco gn - это [...]

в комментариях. Так что следите за комментариями, которые неожиданно останавливают включение.

pr.iseit.net

En caso de que estos nombres le

[...] resulten extra o s , от y до p r oc eden del [..]

Operador Intervalo, mientras que DateDate procedure de la columna Jerarqua.

msdn.microsoft.com

Если вам интересно, эти

[...] странные имена, th e From a n d To c om e от [...]

Оператор диапазона, а DateDate берется из столбца Hierarchy.

msdn.microsoft.com

Resea de la publica ci n от A r ti s t до - Gestin colectiva [...]

de los derechos de autor

wipo.int

От художника к аудитории - Коллективное управление авторскими правами

wipo.int

от D e fen c e до D e ve , что позволяет исключить все необходимые процедуры y centrarse en reorientar los recursos militares, tanto humanos como materiales, hacia el desarrollo Sustentable и la Restauracin ambiental.

ghri.gc.ca

«От обороны к развитию» утверждает, что Южная Африка должна выйти за рамки узкой концепции процесса и вместо этого сосредоточиться на перенаправлении военных ресурсов, как человеческих, так и материальных, на устойчивое развитие и восстановление окружающей среды.

ghri.gc.ca

Antes del Foro Social Mundial

[...] Празднование в Найроби в 2007 году, CIBS организует участие в собраниях представителей организаций, не являющихся губернаторами, в воссоединении с титулом ЮНЕСКО и c h до p o li c y до c c c

daccess-ods.un.org

Перед Всемирным социальным форумом в Найроби в 2007 году ICSW организовал участие всех представителей неправительственных организаций во встрече ЮНЕСКО на тему «От исследований к политике к действиям».

daccess-ods.un.org

(PDF) Исследование окружающей среды и поведение гороховой тли при колонизации, связанное с экспрессией гена кормления

Уровни

были обнаружены у рабочих, собирающих пищу, чем у рабочих гнезд [17–

19].Тем не менее Ingram et al. [20] недавно выделили более

сложный паттерн экспрессии гена for у комбайнов

фуражиры: для изменений экспрессии в течение дня

в соответствии с специфическим для задачи циркадным ритмом, наблюдаемым у

этого вида. Подобное колебание уровня экспрессии for

наблюдалось у медоносных пчел с течением времени [14]. Более точное и систематическое исследование

экспрессии гена for в сочетании с тщательным анализом поведенческих черт

, вероятно, является лучшим подходом

для понимания механизмов, с помощью которых for модулирует поведение насекомых

.

Недавнее секвенирование генома гороховой тли Acyrthosiphon pisum

и его последующая автоматическая аннотация [21] предоставили

заметный инструмент для характеристики гена for у клональных видов

, демонстрирующих высокую поведенческую пластичность. В этом исследовании

мы сначала клонировали кДНК гена кормления гороховой тли

ортолога Apfor. Затем мы проанализировали паттерны их экспрессии

на партеногенетических стадиях развития, морфах и вариантах поведения

иоральных вариантов.Мы также исследовали, могут ли условия окружающей среды

(низкая и высокая плотность населения, определяющие доступность пищевых ресурсов

) влиять на экспрессию Apfor. Наши эксперименты показали, что Apfor высоко экспрессируется на ключевых стадиях развития

и у бескрылых взрослых особей, выращиваемых в условиях скученности.

Активность фермента PKG, измеренная в поведенческих вариантах

, подтверждает наблюдаемые вариации экспрессии Apfor. Затем мы предполагаем, что

предположим, что Apfor может вызвать переход от сидячего поведения

к исследовательскому поведению.Наши результаты закладывают основу

для более детального анализа роли Apfor в поведенческой пластичности

гороховой тли.

Материалы и методы

Штамм тли

Клон YR2 гороховой тли Acyrthosiphon pisum был предоставлен

Дени Тагу (INRA, Ренн, Франция). В нем естественным образом обитает вторичный эндосимбионт Regiella Inсектикола

. Тли выращивали в цветочном горшке

диаметром 15 сантиметров, содержащем 3 растения фасоли Vicia

fabae, при температуре 18 ° C при цикле свет / темнота 16/8, который обеспечивает партеногенное размножение

(первородящие самки).Тли выращивались параллельно

при низкой и высокой плотности популяции.

Клонирование гена кормления A. pisum

мРНК PolyA + экстрагировали из 100 мг цельных

гомогенизированных взрослых бескрылых живородящих самок Acyrthosiphon pisum

с использованием набора для очистки микромРНК (GE Healthcare). Специфические кДНК

были амплифицированы с использованием 0,5 мг полиА + мРНК согласно

с набором для амплификации кДНК BD Smart

TM

RACE с последующим использованием протокола

BD Advantage

TM

2 PCR Enzyme System (BD Biosci-

ences) со специфическими праймерами, созданными на основе последовательности EST

, доступной в AphidBase (www.aphidbase.com) и кодирует партиал

для кДНК (смысловой праймер: GAGTGGAGGTGAGCAGAG, антисмысловой праймер

: CACTTTTCCGGAGGTCATAG). Эти праймеры

совпадают с областью первого тандемного цГМФ-связывающего мотива

гена for. Амплифицированные фрагменты клонировали с помощью набора TA

CloningHkit (Invitrogen) с использованием вектора pCRh3.1 и

трансформировали в электрокомпетентные клетки E. coli One shotHTOP10

(Invitrogen). Рекомбинантные плазмиды из положительных клонов были экстрагированы, очищены и секвенированы GATC Biotech (Констанц,

, Германия)

.Полученные последовательности были протестированы на гомологию с известными генами

с использованием базы данных NCBI. Затем были идентифицированы две гомоло- гические последовательности

, соответствующие им, и названы вариант 1 и вариант 2. На основе этих двух последовательностей были сконструированы праймеры

для амплификации соответствующих полноразмерных кДНК

из свежевыделенных образцов мРНК полиА +

(вариант 1 мРНК смысловой праймер:

ACTGTTGCTTCAGTCGCTGTTTACA, вариант 2 мРНК

смысловой праймер: CAGCGTCTATCTACGTATGTGC, общий антисмысловой праймер

: GTAAAATCGTTGAGGCGGACAA).Отсутствие

гомологичных генов у эндосимбионтов YR2 составило

, что подтверждено с использованием общедоступных аннотаций геномов первичного симбионта

Buchnera aphidicola и вторичного симбионта Regiella

Insecticola.

Коллекция вариантов поведения

Варианты поведения были получены при двух различных условиях плотности популяции

. Бескрылые живородящие взрослые особи (VWL)

были извлечены в условиях низкой плотности популяции, что

обеспечивает хорошее качество пищи и большое пространство для размножения самок.

Для этой цели пять самок были перенесены в цветочный горшок, и

их однодневное взрослое потомство, сосущее листья, было

собрано в одно и то же время утром. Другие поведенческие варианты

были получены при высокой плотности популяции, инициированной

от пяти самок, перенесенных на цветочный горшок и оставленных там, давая

рост нескольким поколениям, пока не были достигнуты условия скопления.

Затем были собраны образовавшиеся крылатые тли (VW), когда они

были однодневными (низкая выживаемость без свежих растений).В то же время

, некоторые бескрылые взрослые особи тли покинули растения, начав ходить

и исследовать среду обитания (названные взрослые бескрылые фуражиры

VWLf), в то время как другие продолжали питаться стеблями или листьями (названные

бескрылые оседлые скученные взрослые особи VWLc ). VWLf и VWLc

были собраны в одно и то же время примерно через 3 часа после того, как первые

особей начали ходить по стенкам клетки, что может составлять

в любое время дня.

Количественные ПЦР-анализы в реальном времени

мРНК PolyA + экстрагировали, как описано выше, из

100 мг целых особей Acyrthosiphon pisum на различных стадиях развития

: личинки 1-й стадии (L1) (около 300 насекомых),

2-я личинки возраста (L2) (около 250 насекомых), крылатые (L3W) и

бескрылые (L3WL) личинки 3-го возраста (около 150 насекомых каждая), крылатые

(L4W) и бескрылые (L4WL) личинки 4-го возраста (около 50 насекомых)

каждый), крылатые (VW) и бескрылые живородящие взрослые особи (VWL) (около

40 насекомых каждый).Пробы от L1 до L4 были отобраны через 2 дня после линьки, и

взрослых особей были собраны в возрасте 1 дня. Варианты поведения (около 40

насекомых каждого VW, VWL, VWLc и VWLf) отбирали в условиях

, как описано выше. Эксперименты проводились на тлей

целиком, а не на головках тлей, поскольку выделение голов

из L1 и L2 было трудным и трудоемким процессом. КДНК

транскрибировали с использованием обратной транскриптазы

(Invitrogen) SuperScript

TM

(Invitrogen) в соответствии с инструкциями поставщика

с использованием 1 мг полиА + мРНК.Эффективность каждой реакции обратной транскрипции

тестировали путем амплификации полученных кДНК

с различными наборами праймеров, используемых в

, после реакций кПЦР с использованием ДНК-полимеразы UptiTherm

(Uptima). Реакции количественной ПЦР проводили для каждого образца кДНК

с использованием прибора qPCR MasterMix Plus для SYBRHGreen I No

Rox (Eurogentec, Бельгия) на приборе DNA Engine Opticonh3

(Bio-Rad) при следующих условиях количественной ПЦР: 50 мкК

в течение 2 минут, 95uC в течение 7 минут, 406 (95uC в течение 30 секунд, 60uC в течение 30 секунд,

72uC в течение 45 секунд) и специальных праймеров (Таблица S1).

Внутренний фрагмент рибосомного белка Rpl7 A. pisum

(доступ в Genbank NM001135898) использовали в качестве контроля для нормализации экспрессии

(RPL7-2QPCR вперед: ACTGTT-

CAGATTGCGTCAGATC, RPL7 -2QPCR

AGTTCCCTTACGCTCTTCAAGT). Все реакции проводили

в трех повторностях для каждой кДНК, полученной по меньшей мере из четырех

независимых экстракций мРНК. Количественную оценку относительных уровней мРНК

рассчитывали с использованием метода DDCt [22].Среднее значение и стандартная ошибка

были рассчитаны для каждого экспериментального условия.

Ген, добывающий пищу для гороховой тли

PLOS ONE | www.plosone.org 2 мая 2013 г. | Том 8 | Выпуск 5 | e65104

ПЭТ-исследования маркера глиальных клеток TSPO у пациентов с психозами

% PDF-1.5 % 424 0 объект > эндобдж 426 0 объект > поток application / pdf

  • Pontus Plavén-Sigray, MSc1 *; Грэнвилл Дж. Мэтисон, магистр 1; Карин Коллсте, MD, PhD1; () и Абхишех Х. Ашок, MBBS2,3,4; Дженнифер М.Coughlin, MD 5,6; Оливер Д. Хоус, доктор медицины, доктор философии 2,3,4; Ромина Мизрахи, доктор медицинских наук7; Мартин Г. Помпер, доктор медицины, доктор философии5,6; Пабло Русян, PhD7; Маттиа Веронезе, доктор философии 8; Ючуань Ван, доктор философии 6; Саймон Червенка, доктор медицины, доктор философии 1 () и (1 Отделение клинической неврологии, Центр исследований психиатрии, Каролинский институт и Совет графства Стокгольм, SE-171 76 Стокгольм, Швеция. 2IoPPN, Королевский колледж Лондона, Парк Де Креспиньи, Лондон, SE5 8AF, Великобритания 3MRC Лондонский институт медицинских наук, больница Хаммерсмит, Лондон W12 0NN.4 Институт клинических наук (ICS), медицинский факультет, Имперский колледж Лондона, Du Cane Road, Лондон W12 0NN. 5 Кафедра психиатрии и поведенческих наук, Медицинские учреждения Джона Хопкинса, Балтимор, Мэриленд, США. 6Рассел Х. Морган, Отделение радиологии и радиологической науки, Медицинские учреждения Джона Хопкинса, Балтимор, Мэриленд, США. 7 Университет Торонто, Департамент психиатрии, Торонто, Канада. 8 Кафедра нейровизуализации, Институт психиатрии, психологии и нейробиологии, Королевский колледж Лондона, Лондон, Великобритания.)
  • ПЭТ-исследования маркера глиальных клеток TSPO у пациентов с психозами - метаанализ с использованием данных отдельных участников
  • 2017-12-04T11: 08: 52 + 01: 00LaTeX с пакетом hyperref2021-05-14T20: 17: 57-07: 002021-05-14T20: 17: 57-07: 00позитронно-эмиссионная томография, психоз, шизофрения, белок транслокатор, микроглия, иммуноактивация, метаанализ2.2uuid: 0e8f941d-1dd2-11b2-0a00-5408275d6100uuid: 0e8f9420-1dd2-11b2-0a00-aa0000000000 конечный поток эндобдж 423 0 объект > эндобдж 121 0 объект > эндобдж 9 0 объект > эндобдж 126 0 объект > эндобдж 4 0 obj > эндобдж 68 0 объект > эндобдж 107 0 объект > эндобдж 147 0 объект > эндобдж 317 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 319 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 320 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 321 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 322 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 323 0 объект > / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 439 0 объект [441 0 R 442 0 R] эндобдж 440 0 объект > поток H | Vn8} 7 X4 / f6 l [b ، TR # F93g (EN & / dw + x ֥ j ~ "73 (` go ^ B, NXFw; vͼ Zm "} ~ icSmO | Jqqg5 {

    Jc%> Ӊ ? a2 / = Fh

    Дистанционное микроволновое зондирование для моделей океанографических и морских прогнозов погоды

    Об этой книге

    Введение

    Возможности микроволнового дистанционного зондирования для изучения Мирового океана были окончательно продемонстрированы миссией SEASAT в 1978 году.С тех пор больше не было спутниковых приборов для получения дополнительных данных такого типа. Однако предлагаемый запуск спутника ЕКА ERS-1 приведет к запуску нового набора активных микроволновых приборов в космос в 1990 году. Хотя аналогичные данные были получены с помощью бортовых приборов SAR, рефлектометров, высотомеров и т. Д. - отличный результат. В настоящее время ведется активная работа по развитию необходимого опыта в обработке и анализе таких данных, когда они поступают с ERS-1 и с последующих спутников.Именно на этом фоне Отдел по научным вопросам НАТО снова согласился спонсировать ASI в Данди в 1988 году. Его цель состояла в том, чтобы проанализировать существующие знания об извлечении морских и атмосферных геофизических параметров из микроволновых данных, полученных со спутников, и позволить ученым подготовить себя и свои вычислительные системы к использованию новых данных, когда они станут доступны. Важность данных в основном заключается в том, что они являются входными параметрами, помогающими подбирать граничные условия в больших компьютерных моделях.Курс был больше посвящен приборам, не создающим изображения, то есть пассивным радиометрам, высотомерам и рефлектометрам, чем (отображающим) радиолокаторам с синтезированной апертурой.

    Ключевые слова

    Океанография Радиометр Дождь Погода Ветер морской спутник

    Редакторы и филиалы

    1. 1.Департамент прикладной физики, электроники и производства, Университет Данди, Данди, Шотландия, Великобритания

    Библиографическая информация

    • Заголовок книги Дистанционное микроволновое зондирование для моделей океанографических и морских прогнозов погоды
    • Редакторы Робин А.Vaughan
    • Название серии Серия НАТО ASI
    • DOI https://doi.org/10.1007/978-94-009-0509-2
    • Информация об авторских правах Springer Science + Business Media B.V.1990 г.
    • Имя издателя Спрингер, Дордрехт
    • электронные книги Архив книг Springer
    • ISBN в твердом переплете 978-0-7923-0581-1
    • ISBN в мягкой обложке 978-94-010-6715-7
    • электронная книга ISBN 978-94-009-0509-2
    • Серия ISSN 1389-2185
    • Номер издания 1
    • Количество страниц XII, 406
    • Количество иллюстраций 0 ч / б иллюстраций, 0 иллюстраций в цвете
    • Темы Науки об атмосфере
      Океанография
    • Купить эту книгу на сайте издателя

    Обзоры

    ` Это чрезвычайно информативная и современная книга, которая должна быть на полке у тех, кто будет использовать новые микроволновые спутниковые данные, поступающие с датчиков в течение 1990-х годов. '
    Бюллетень всемирной метеорологической организации, 40: 1

    Международный центр изучения права и религии

    Кейсы для освобождения заключенных - 1 января 2018 г.

    Говард Фридман, Оговорка о религии

    In Нджие против Юрковича , (7-й округ, янв.5, 2018), 7-й округ отменил решение районного суда об отклонении иска сокамерника растафари, придя к заключению, что районный суд ошибочно пришел к выводу, что все иски дублируют иски в другом ожидающем рассмотрении иске.

    В деле Хоскинс против Спиллера , 2018 U.S. Dist. LEXIS 364 (SD IL, 2 января 2017 г.), федеральный окружной суд штата Иллинойс без ущерба отклонил жалобу заключенного-мусульманина на религиозную диету и соблюдение Рамадана. Он разделил и позволил истцу отдельно подавать жалобы на условия молитвы и религиозную диету в другом учреждении, в которое он был переведен.

    В деле ЛеБарон против Массачусетского партнерства по исправительному здравоохранению , 2017 U.S. Dist. LEXIS 213577 (штат Массачусетс, 1 декабря 2017 г.), федеральный магистратский судья Массачусетса рекомендовал отклонить иски заключенного-мессианского еврея, в которых навесили на него ярлык психического заболевания и заставили принимать лекарства для психического здоровья, что существенно затрудняет его свободное исповедание религии.

    В деле Агилар против Линдермана , 2018 U.S. Dist. LEXIS 954 (ДЗ, 2 января 2018 г.), федеральный окружной суд штата Аризона разрешил заключенному, который является приверженцем Ассамблеи Яхува-Иса, подать жалобу на религиозную диету, но отклонил жалобы на неадекватные религиозные обеды. и отказ доставить религиозную литературу, отправленную ему по почте.

    In Wonsch v. Garner , 2018 U.S. Dist. LEXIS 74 (WD OK, 2 января 2018 г.), федеральный окружной суд Оклахомы принял рекомендацию магистрата (округ США LEXIS 213803, 2017 г., 22 ноября 2017 г.) и отклонил иск заключенного о том, что ему было отказано в доступе к духовенству, и был обязан пройти 8-недельный курс изучения Библии, чтобы получить разрешение на крещение.

    In Townsend v. Ouellette , 2018 U.S. Dist. LEXIS 1427 (WD MI, 4 января 2017 г.), федеральный окружной суд штата Мичиган разрешил заключенному-буддисту подать жалобу о том, что ему отказали в приеме веганской добавки с витамином B-12, но отклонил его жалобы относительно ограничений на употребление религиозных масел. и отказ в сдаче анализа крови на ПСА вместо цифрового ректального исследования, что противоречит его религиозным убеждениям.

    In Watford v. Newbold , 2018 U.S. Dist. LEXIS 1636 (SD IL, 4 января 2018 г.) и федеральный окружной суд штата Иллинойс отклонили иск заключенного о том, что отказ в стоматологическом и медицинском лечении нарушает его религиозное обязательство должным образом заботиться о своем теле.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *