Эпоха энеолит: Эпоха энеолита и бронзового века — Волгоградский областной краеведческий музей

Содержание

Эпоха энеолита и бронзового века — Волгоградский областной краеведческий музей

ЭНЕОЛИТ (от лат. aeneus – медный и греч. lithos – камень, дословно: меднокаменный) – период между неолитом и бронзовым веком, когда началось внедрение и использование медных изделий. Это привело к деградации кремнёвой индустрии, обеднению наборов каменных орудий. Археологические памятники периода энеолита на территории Волго-Донского междуречья и Заволжья крайне редки, вероятно, из-за преобладания здесь подвижных форм скотоводства. Они представлены небольшими поселениями (Репин хутор, Каменка, Кумыска и др.) и единичными курганными погребениями (могильник Шляховский, Весёлый IV и др.).

Кремневые тесла, пластина и каменный скипетр из кургана у хутора Шляховский

 

БРОНЗОВЫЙ ВЕК (IV – II тысячелетие до н. э.) – эпоха функционирования изделий из бронзы (сплав меди с оловом) представлена древнеямной, катакомбной и срубной культурно-историческими общностями.

Погребения древнеямной культуры совершались в больших прямоугольных или круглых ямах, костяк на спине с согнутыми в коленях ногами, часто окрашены охрой; инвентарь беден: круглодонные сосуды, каменные «скипетры», топоры, бронзовые ножи. По всей видимости, ямные племена были первыми скотоводами Нижней Волги. Меньшее значение имело земледелие, в основном, в поймах малых рек. Происхождение ямной культуры объясняется либо эволюцией населения Волго-Уральского междуречья при воздействии центров производящего хозяйства через Кавказ или Восточный Прикаспий, либо влиянием со стороны трипольской культуры.

В III тысячелетии до н.э., в эпоху среднего бронзового века ямная культура сменяется катакомбной, пришедшей с Северного Кавказа. Захоронения этой культуры (одиночные и коллективные) производились в погребальных камерах катакомб в скорченном положении на боку; в могилах встречаются охра и уголь в жаровнях и курильницах. Плоскодонная керамика отличается разнообразием форм, распространен шнуровой орнамент.

Известны каменные и бронзовые топоры, молоточковидные булавки, ножи, украшения, каменные булавы. Катакомбные племена занимались скотоводством и земледелием. В результате интенсивных раскопок выявлено множество погребений на территории Волгоградской области и на Северном Кавказе, поселения изучены хуже.

 

Во второй четверти II тыс. до н.э. катакомбные племена в наших степях сменяют племена срубной культурно-исторической общности позднего бронзового века. Памятники срубной культуры (поселения, грунтовые и курганные могильники) распространены в степях от Днепра до Заволжья. Обряд захоронения предусматривал захоронения в ямах или деревянных срубах (отсюда название культуры), характерное положение покойника – скорченное, на левом боку, кисти рук перед лицом. Инвентарь однообразен, бытуют баночные и острореберные сосуды; среди бронзовых изделий выделяются ножи, топоры, позже – кельты, серпы, жатвенные ножи. Вопросы происхождения и датировки срубной культурно-исторической общности остаются дискуссионными.

У носителей срубной культуры широкое развитие получили бронзолитейное производство, а также скотоводство и земледелие. На территории края известны многочисленные могильники (Ильевка, Первомайский, Писаревка, Нагавский и др.) и поселения (Донская стоянка, Пятиморская стоянка и др.).

 

Эпоха энеолита

Энеолит лесостепного и степного Алтая (сер. IV–III тыс. до н.э.)

   Особенности географической среды оказывали огромное воздействие на процессы расселения человека в древности и на освоение им различных районов степей Евразии. Энеолитические памятники лесостепного Алтая были открыты в 60-е г. XX века в результате работ Б.Х. Кадикова в предгорной зоне, но длительное время они оставались неизвестными.

    Стационарные работы на оз. Иткуль и комплексе поселений у д. Павловка и Алексеевка в верховьях рек Баранулки и Касмалы позволили выделить памятники или отдельные комплексы на многослойных, которые занимают промежуточное положение между неолитическими и памятниками эпохи бронзы, то есть относятся к эпохе энеолита.

Сейчас известны памятники, давшие энеолитические материалы. Это поселения: Костенкова Избушка, Ляпустин Мыс, Коровья Пристань-1 и 3 и другие — на оз. Иткуль, Комарово-1, Исток, Пасечное, Волчиха, Цыганкова Сопка-1, 2 и 4.

 

©​ «История Алтая»,1995

Наконечники стрел

Большемысская культура

Памятники эпохи энеолита лесостепного Алтая выделены в большемысскую энеолитическую культуру, названную по могильнику Большой Мыс на оз. Иткуль. Большая часть инвентаря энеолитических памятников лесостепного и степного Алтая, которые датируются обычно в пределах IV-III тыс. до н.э., находит многочисленные аналогии в материалах позднего неолита-энеолита соседних регионов. Памятники большемысской культуры датируются в пределах второй половины IV-III тыс. до н.э.

   Каменный инвентарь населения большемысской культуры самый разнообразный. Это шлифованные и сверленые топоры, многочисленные тесла, ножи, наконечники дротиков и стрел, долота, скребла, скребки, резцы, ножевидные платины.

   Особенностью энеолитических памятников являются  шлифованные ножи с прямыми вогнутым лезвием и комбинированные орудия, представляющие собой сверла-пилки. Из кости сделаны мотыги, долота, гарпуны, наконечники стрел. Из лезвий изготовлены лезвия составных ножей и шилья.  

Погребальный обряд отличается однообразием. Все погребенные лежат на спине в вытянутом положении, голова наклонена к правому или левому плечу, руки на поясе. Все захоронения грунтовые, большинство- одиночные. Отличительной чертой погребального обряда является обилие украшений, небольшое количество каменного инвентаря и почти полное отсутствие керамики.  Многочисленные подвески, нашивки и бусы изготовлены из клыков кабана, резцов лошади, бобра, медведя и барсука. Украшения нашивались на головные уборы, одежду и пояс. Носились они на груди и шее.

   Энеолитическое население представляло собой смешанный антропологический тип, сложившийся в процессе длительных контактов монголоидов и европеоидов. По мнению исследователей, поселение относились к южной средиземноморской ветви европеоидной расы. Внешний облик представителя этой культуры восстановлен в ходе реконструкции по лицевым костям черепа из погребения могильника Большой Мыс в лаборатории пластической реконструкции, созданной известным антропологом М.М. Герасимовым при институте этнографии Академии наук.

   В процессе формирования культуры энеолитического населения лесостепного Алтая приняли какое-то участие и энеолитические племена афанасьевской культуры  Горного Алтая, о чем свидетельствуют материалы могильника Усть-Иша.  

Когти медведя от перчатки шамана

Погребение Большой Мыс

press to zoom

Череп шамана и его реконструкция.

Погребение Большой Мыс

press to zoom

Жезл шамана из кости лося

Погребение Большой Мыс

press to zoom

Афанасьевская культура получила название по могильнику на берегу Енисея. На Алтае известны могильники и поселения: Усть-Кокса, Усть-Куюм.

Афанасьевские родовые кладбища состоят из кольцевидных каменных оградок. В центре ограды одна-две прямоугольные грунтовые ямы. Они устраивались на равнинах недалеко от реки. Известны как одиночные, так и групповые погребения. Скелеты лежат в скорченном положении, преимущественно на боку или на спине. В могилах в ногах или у головы погребенного ставили глиняные сосуды, клали куски мяса домашних или диких животных, орудия труда, одежду украшали  нашивками и амулетами из костей и клыков животных. 

Реконструкция могильника

Афанасьевская культура (кон. IV–II тыс. до н.э.)

press to zoom

   Основной инвентарь афанасьевских погребении — яйцевидные глиняные сосуды. Орудий труда в могилах мало. Это каменные песты, поделки из рога и кости, наконечники стрел. В качестве украшений широко использовались зубы животных, раковины, кость.Встречаются немногочисленные металлические предметы — это небольшие медные ножи, проволочные колечки, медные кинжалы, серьги, браслеты, подвески.  

   Хозяйство населения афанасьевской культуры характеризуется двумя чертами: развитием скотоводства и началом металлургии меди. Сохранялась охота, рыбная ловля и собирательство. С изучением данной культуры связана важная проблема — это происхождение населения и самой культуры. Афанасьевцы принадлежали к европейской расе.

Антропологический тип и инвентарь не имеют связи с местной неолитической культурой. Наблюдается сходство керамики, антропологического типа и обряда погребения с древнеямной культурой Восточной Европы.

Реконструкция захоронения женщины

Афанасьевская культура (кон. IV–II тыс. до н.э.)

press to zoom

Инвентарь. Украшения

Афанасьевская культура (кон. IV–II тыс. до н.э.)

press to zoom

  В экспозиции «Энеолит» представлена реконструкция погребения афанасьевской археологической культуры. Он включает скелет женщины, которая была погребена вместе с предметами домашнего быта.

Это – два керамических сосуда, оселок (каменное орудие для заточки ножей). Погребение сооружалось следующим образом. В выкопанную яму клали тело умершего с предметами, которые должны были пригодиться в загробной жизни. Сверху возводили каменный или земляной холм в зависимости от местности. такое погребальное сооружение именуется курганом.

16.03.2016

ПРОЕКТ «КАФЕДРА»

ДРЕВНЕЙШИЕ СКОТОВОДЫ И МЕТАЛЛУРГИ АЛТАЯ:

АФАНАСЬЕВСКАЯ КУЛЬТУРА

​ В научно-просветительском проекте «Кафедра»  доктор исторических наук, доцент кафедры археологии, этнографии и музеологии исторического факультета АлтГУ Сергей Грушин рассказал о том, что Сибирь своим развитием обязана афанасьевскому населению.

   В 1922 году выдающимся российским учёным, археологом Сергеем Теплоуховым была выделена археологическая культура бронзового века, впоследствии названная афанасьевской.

Ссылка:

​www.vesti22.tv.

Королев

40 лет Средневолжской археологической экспедиции: Краеведческие записки / Отв.ред Л.В. Кузнецова. – Самара: ООО «Офорт», 2010. – 280 с.: ил. – (Выпуск XV).

А.И. Королев

Средневолжская археологическая экспедиция: история и итоги изучения энеолита

С.30

До 70-х гг. XX в. на территории Куйбышевской (Самарской) области энеолит оставался почти неизвестным. В распоряжении археологов были лишь отдельные свидетельства этой эпохи – погребение, открытое В.В. Гольмстен у с. Криволучье (Гольмстен, 1931), и каменное навершие скипетра из Куйбышевского областного краеведческого музея. Не лучше или ненамного лучше энеолит был изучен в соседних регионах степи-лесостепи. Решительное изменение ситуации наметилось в связи с открытием Куйбышевского государственного университета и особенно с началом широких исследований археологической экспедиции КГПИ под руководством И.Б. Васильева. Наряду с изучением эпох неолита, бронзы, раннего железного века, изучение энеолита постепенно выделилось как самостоятельное направление. На территории Куйбышевской области были развернуты планомерные археологические исследования, ориентированные на поиск и последующие раскопки памятников меднокаменного века. Уже вскоре были получены важные результаты: в 1972 г. на р. Самаре в Богатовском районе Куйбышевской области Г.Г. Пениным была открыта Виловатовская стоянка, а в 1973 г. им же около с. Съезжее был открыт грунтовый могильник, ставший опорным памятником для выделения культуры раннего энеолита. Съзженский могильник был изучен под руководством И.Б. Васильева и Г.И. Матвеевой в 1974, 1975 и 1977 гг. (Васильев, Матвеева, 1979). На основании полученных данных была осуществлена достаточно детальная характеристика погребального обряда и инвентаря самарской археологической культуры, а полученная здесь коллекция керамики стала эталонной для изучения гончарных традиций населения самарской культуры. Был проведен анализ антропологических материалов, чрезвычайно важных для решения вопросов происхождения и взаимодействия населения эпох неолита – раннего металла (Яблонский,1986а. С.22-24; 1986б. С.94-108).

Степь и лесостепь к востоку от Дона к этому времени были изучены значительно слабее, чем западные области и лесная полоса и, планируя исследования энеолита, И.Б. Васильев с самого начала не ограничивался пределами Куйбышевской области. Так, в середине 70-х гг. в Оренбургском течении р. Самары были раскопаны I и II Старо-Елшанские стоянки, осмотрена Старо-Елшанская береговая и ряд других стоянок, в керамических коллекциях которых были выделены энеолитические материалы близкие съезженским, а также керамика, сопоставленная с волосовской (Пенин, 1976. С.10-11; Васильев, Пенин, 1977. С.3-22). В 1978-1980 гг. неподалеку от с. Алексеевка Хвалынского района Саратовской области был изучен могильник Липовый Овраг, который содержал материалы, существенно дополнившие представления о погребальном обряде самарской культуры (Васильев, 1980. С.27-31). В ходе раскопок Виловатовской стоянки в 1977-1979 гг. среди других групп керамики была выделена энеолитическая, в том числе, небольшая коллекция бытовой посуды самарской культуры (Васильев, Выборнов, Габяшев, Моргунова, Пенин, 1980. С.151-189). В эти же годы Н.Л. Моргуновой была раскопана Ивановская стоянка на р. Ток (бассейн р. Самары в пределах Оренбургской области), содержащая воротничковую керамику близкую самарской, а также керамику, объединенную Н.Л. Моргуновой и И.Б. Васильевым в токский и турганикский типы. Авторы исследований отмечали черты лесных культур, волосовской и турбинской (гаринской) в токской керамике, в то же время, фиксируя довольно существенные различия, не позволяющие включить этот тип в состав упомянутых культур, указывали на ее особую близость икско-бельским материалам (Моргунова,1980. С.104-124; Васильев, 1981. С.9-10). В дальнейшем, Н.Л. Моргунова объединила токскую керамику с ивановским этапом самарской культуры (Моргунова,1989. С.118-135). Большую роль в понимании лесостепной линии развития энеолита Волго-Уралья сыграли материалы Турганикской стоянки, изученной раскопками в 1982 году (Моргунова,1984. С.58-78).


© Королев А.И., 2010
С.31

И.Б. Васильев очертил круг стадиально близких турганикскому типу признаков в алексеевских, репинских и материалах среднего слоя Михайловского поселения, черты волосовско-турбинской и кысыкульско-суртандинской керамики и отнес его к восточному кругу памятников (Васильев, 1981. С.45-49). Н.Л. Моргунова остановилась на тех же аналогиях, указала на преемственность токской и турганикской керамики, отметила возможное влияние на формирование турганикского типа волосовских, суртандинских и ботайских материалов и определила ее хронологию первой половиной III тыс. до н.э. (Моргунова, 1984. С.133-134). К волосовской культуре была отнесена часть коллекции с Шигонского II поселения (Выборнов, 1980. С.15-16). Полученные в ходе исследований погребальных и поселенческих памятников самарской культуры данные позволили перейти к первым обобщениям. И.Б. Васильев, проведя сравнительный анализ самарской, прикаспийской, нижнедонской и азово-причерноморской культур, выявил их значительную близость и предложил объединить в рамках мариупольской историко-культурной области раннего энеолита. Результаты исследований И.Б. Васильева в полной мере нашли отражение в его диссертации и других работах (Васильев, 1979; Васильев, 1980, С.27-52; Васильев, 1981). Большое значение в плане представления новых материалов и их интерпретации имела представительная конференция по проблемам изучения энеолита степи и лесостепи Восточной Европы проведенная в г. Оренбурге в 1980 г. Материалы конференции, изданные в виде сборника статей (Энеолит Восточной Европы. Куйбышев, 1980), имели фундаментальное значение для дальнейших исследований. Отметим в этой связи, что организация издательской деятельности стоила немалых усилий, но она определялась необходимостью скорейшей публикации вновь полученных источников.

По материалам Алексеевской стоянки в Саратовской области был выделен алексеевский тип керамики, совмещающий в себе по представлениям И.Б. Васильева как степные (древнеямно-среднестоговские), так и лесные (волосовские) черты (Васильев, 1978. С.173-174). В 1977-79 гг. в Хвалынском районе Саратовской области И. Б. Васильевым, С.А. Агаповым, В.И. Пестриковой был исследован I Хвалынский могильник – один из наиболее значимых памятников энеолитической эпохи Восточной Европы, позволивший рассматривать Нижнее и Среднее Поволжье в контексте развития энеолитических культур Восточно-Европейской степи, связать хвалынские и ранние подкурганные материалы и наметить пути решения проблемы происхождения ямной культуры в Волго-Уралье (Агапов, Васильев, Пестрикова, 1979. С.36-63). Характеристика выделенной по материалам могильника хвалынской энеолитической культуры вскоре была дополнена результатами исследований Хлопковского могильника (Малов, 1982. С.82-94; 2008. С.32-134), разрушенного Ивановского могильника и стоянки (Моргунова, 1979. С.15-21) поселенческих памятников в Северном Прикаспии, в Оренбургской, Самарской областях. Добавим к этому более поздние материалы, полученные в Пензенской области, в Мордовии и Чувашии. В этом контексте стала очевидной неслучайность криволучского комплекса.

Определенным итогом изучения I Хвалынского могильника стала защита В. И. Пестриковой кандидатской диссертации в ИА РАН в 1987 г. (Пестрикова, 1987). В этом же году неподалеку от I Хвалынского могильника И.Б. Васильевым, С.А. Агаповым, В.И. Пестриковой был открыт и раскопан II Хвалынский могильник, уступающий по количеству захоронений первому, но не уступающий ему по значимости погребального инвентаря.

Результаты раскопок могильников самарской и хвалынской культур показали, что их значение далеко выходит за пределы собственно Поволжья. Вместе с этим в изучении степного энеолита выявилась явная диспропорция, объясняющаяся слабой степенью изученности территории Северного Прикаспия, и с 1980 г. под руководством И.Б. Васильева начинается планомерное изучение этого региона. Задачи Прикаспийской экспедиции были сформулированы следующим образом: «детальное обследование отдельных микрорайонов, выявление памятников с культурными слоями и их раскопки, привязка к этим эталонным памятникам развеянных стоянок, выделение культурных типов памятников и, в итоге, составление культурно-хронологической схемы региона» (Васильев, 1989. С.3). Во многом успешная деятельность экспедиции в непривычных условиях пустыни объясняется завязавшимся в 1979 г. сотрудничеством И.Б. Васильева с прекрасным знатоком пустыни, сотрудником Досангской противочумной станции П.С. Дубягиным.


С.32

Основными сотрудниками Прикаспийской экспедиции стали И.Б. Васильев, П.П. Барынкин, А.А. Выборнов, Е.В. Козин, Ю.И. Колев, А.М. Комаров, П.Ф. Кузнецов, А.А. Ластовский, А.Е Мамонов). В работах экспедиции приняли участие сотрудники и студенты исторического факультета КГПИ, школьники – участники археологических кружков. Энеолитическое направление экспедиции вели И.Б. Васильев и П.П. Барынкин. Полученные результаты оперативно вводились в научный оборот (Дубягин, Чикризов, Чуринов, Васильев, Выборнов, 1982. С.95-134; Барынкин, Васильев, 1985. С.58-75). Среди выявленных местонахождений набольшее значение имели стоянки с сохранившимся культурным слоем. С 1980 г. начинается исследование опорного памятника хвалынской культуры с сохранившимся культурным слоем – поселения Кара-Худук. Кроме хвалынской, здесь была обнаружена керамика, имеющая аналогии в краснодарских материалах поселения Свободное, а также коллекции кремневых и кварцитовых орудий, изделий из раковин, остеологический материал (Барынкин, Васильев, 1988. С.123-142). Не менее важными для исследования хвалынской культуры стали раскопки поселения Каир-Шак VI. Однослойный характер памятника позволил полноценно охарактеризовать камнеобработку и ассортимент кремневых и кварцитовых орудий (Барынкин, 1989. С.106-118). Завершение энеолитической эпохи региона связано с материалами типа Кызыл-Хак I, соответствующими ранним подкурганным погребениям (Барынкин, 1986. С.80-94). Были также получены немногочисленные, но очень ценные материалы раннего энеолита, которые подтвердили существование здесь, выделенной А.Н. Мелентьевым прикаспийской культуры (Мелентьев, 1980. С.12) и позволили уточнить ее содержание и хронологию (Васильев, 1981. С.12-18). Вместе с накоплением материалов актуальным стало уточнение этапов развития, последовательности смены культур, разработка общей периодизации нижневолжского региона. В этом плане необходимо выделить совместную работу И.Б. Васильева и А.А. Выборнова (Васильев, Выборнов, 1986. С.3-20).

Важной чертой прикаспийской экспедиции стало сотрудничество с учеными Института почвоведения и фотосинтеза АН СССР в г.Пущино (ныне – ИФХиБПП РАН), которое позволило в полной мере учитывать динамику природной среды при изучении археологических памятников и периодов (Васильев, Иванов, 1986. С.16-20; Васильев, Иванов, 1995; Лаврушин, Спиридонова, Сулержицкий, 1998. С.40-65). В итоге более чем 10-летних исследований Северный Прикаспий стал одним из наиболее полно и комплексно исследованных регионов, узловым в плане изучения степного энеолита.

Уже в 1981 году появилась большая обобщающая работа И.Б. Васильева «Энеолит Поволжья (степь и лесостепь)», в которой подводились первые итоги изучения меднокаменного века. Изданная как учебное пособие к спецкурсу, она, по сути, явилась полноценным монографическим исследованием, в котором анализировались источники эпохи энеолита, рассматривались вопросы хронологии и периодизации, выдвигались и аргументировались гипотезы, объясняющие происхождение и развитие археологических культур и культурных типов. Развернутую аргументацию получило обоснование мариупольского этапа раннего энеолита, в целом предшествующего хвалынской культуре и хвалынско-среднестоговской общности, отнесенной к развитому этапу. К позднему энеолиту были отнесены материалы древнейших подкурганных погребений, памятники алексеевского, токского, турганикского, алексеевского, репинского, волосовского типов.

Говоря о впечатляющих достижениях куйбышевских археологов, необходимо отметить большие успехи специалистов Воронежа, Йошкар-Олы, Ижевска, Казани, Оренбурга, Уфы, Саратова, Саранска и других центров в изучении энеолитической эпохи. Принципиально важным стало быстрое накопление фонда источников, формирование единого исследовательского пространства, позволяющих изучать как локальные и региональные, так и эпохальные процессы, протекающие на широких пространствах Восточно-Европейской степи-лесостепи.

С середины 80-х гг. развернулись активные полевые работы на территории Куйбышевской области. Ряд интереснейших памятников был выявлен и исследован раскопками в бассейне реки Сок под руководством С.А. Агапова, И.Б. Васильева, П.П. Барынкина, Е.В. Козина, А.Е. Мамонова, Н.В. Овчинниковой, В.И. Пестриковой.


С.33

В этот период были изучены: Гундоровское поселение (И.Б. Васильев, Н.В. Овчинникова, А.Е. Мамонов), I и II Большераковские и Лебяжинская I стоянки (П.П. Барынкин, Е.В. Козин), Чесноковская II (С.А. Агапов, С.С. Бахарев, Н.В. Овчинникова, В.И. Пестрикова), Лебяжинское III поселение (Н.В. Овчинникова), Лебяжинская IV стоянка (Н.В. Овчинникова, А.Е. Мамонов, А.И. Королев), Чекалино IV (А.Е. Мамонов), Попово Озеро (Ю.И. Колев).

В 1984 г. были проведены раскопки на стоянке Чесноковка II (Бахарев, Овчинникова, 1991. С.72-93). Здесь была выделена серия воротничковой керамики самарского и хвалынского типа, группа керамики, близкая волосовскому и токскому типам, керамика с «внутренним ребром». Обнаружение поселенческой хвалынской керамики в полосе лесостепи показало, что распространение хвалынской культуры не ограничивается степной зоной. Интерес представляют два погребения (1 и 3), относящиеся к раннему энеолиту.

Исследование II Большераковской стоянки показало сложную картину местного энеолита с сочетанием материалов степного (воротничковая керамика хвалынской и самарской культур) и лесного населения и дало возможность авторам проводить сопоставление полученных керамических комплексов с лесными культурами: новоильинской, юртиковской, гаринско-борской, волосовской (Барынкин, Козин, 1991. С.94-119). В то же время подчеркивалось их соответствие токскому и турганикскому типам. Необходимо отметить замечание авторов о генетической связи гаринско-борских и степных (типа Пшеничного) памятников (Барынкин, Козин, 1991. C.116).

Важное научное значение имели результаты раскопок Лебяжинской I стоянки, где П.П. Барынкиным и Е.В. Козиным были сделаны тонкие наблюдения о более поздней стратиграфической позиции средневолжской неолитической керамики относительно хвалынского комплекса. До настоящего времени этот комплекс остается наиболее крупным на территории лесостепи (Барынкин, Козин, 1995. С.136-164). Последующие радиоуглеродное датирование керамики средневолжской и хвалынской культуры подтвердило выводы авторов раскопок.

Коллекция Гундоровского поселения была положена в основу характеристики средневолжских материалов волосовской культуры. Памятник представляет особый интерес в силу ряда обстоятельств. Он раскопан почти полностью, содержит остатки жилищ, наиболее крупные в бассейне р. Сок коллекции керамики, каменных орудий, кремневые фигурки, костяной инвентарь, украшения. На территории поселения изучены погребения эпохи энеолита. Полной публикации материалов раскопок пока нет, в ряде печатных работ рассмотрены отдельные комплексы и погребения (Васильев, 1990. С.52-69; Овчинникова, 1990; 2000; Овчинникова, Хохлов, 1998; Васильев, Овчинникова, 2000. С.216-277; Королев, Шалапинин, 2008).

В 1988 г. было открыто и в последующие годы изучено раскопками поселение Лебяжинка III. Здесь было выявлено углубленное в материк жилище, получены крупные коллекции керамики, кремневых и кварцитовых орудий. Особенностью памятника явилась хорошая сохранность кости, представленной как изделиями, так и фаунистическими остатками, костями рыб, что позволило, в частности, осуществить радиоуглеродное датирование. Особенностью керамики явилось сочетание признаков степного и лесного энеолита. Материалы поселения были сопоставлены со вторым (ивановским) этапом самарской культуры, но отмечалась его более ранняя хронология (Овчинникова, 1995. С.164-191). Энеолитические материалы стоянок Чекалино IV и Лебяжинка IV опубликованы лишь частично (Васильев, Овчинникова, 2000. С.237; Овчинникова, 2000). На поселении Лебяжинка IV была обнаружена редкая находка – каменное навершие скипетра в форме головы лошади (Овчинникова, 1996. С.11-15; Васильев, Овчинникова, 2000. С.260).

География исследований САЭ КГПИ, в ходе которых были получены энеолитические материалы, включала и северные области лесостепи на территории Башкирии и Мордовии. Так, совместной экспедицией КГПИ и БГПИ в 1980-81 гг. были проведены раскопки стоянок Сауз I и II, где кроме неолитических комплексов были получены новоильинские и гаринско-борские воротничковые материалы эпохи энеолита, среди которых венчик хвалынского сосуда – самая северная находка такого рода керамики (Выборнов, Овчинникова, 1981. С.33-52; Выборнов, Обыденнов, Обыденнова, 1984. С.3-21; Выборнов, Елизаров, Овчинникова, 1985. С.30-50).


С.34

Многолетние исследования в Волго-Камье позволили перейти к обобщению полученных данных о взаимодействии на этой территории в энеолите лесного и пришлого с юга населения. В частности, в опубликованной в 1982 г. статье И.Б. Васильев и Р.С. Габяшев рассматривают вопросы формирования памятников русско-азибейского типа, отмечают возможность влияния южных культур на волосовские и гаринские древности, предлагают схему развития культур от неолита до бронзы (Васильев, Габяшев, 1982. С.3-23). 1981 г. совместной экспедицией КГПИ и ВГПИ под руководством А.Т. Синюка и И.Б. Васильева были проведены раскопки Черкасской стоянки в Воронежской области (Васильев, Синюк, 1984. С.102-129). С 1980 г. по 1984 г. совместной экспедицией ЛОИА и КГПИ под руководством В.П. Третьякова и А.А. Выборнова, а с 1987 г. А.А. Выборновым и А.И. Королевым проводились работы на территории Мордовии. Результатом этого сотрудничества стал ряд раскопанных и введенных в научный оборот памятников волосовской культуры, была открыта имеркская археологическая культура эпохи энеолита (Выборнов, Третьяков, 1984. С.91-101; 1986; 1987; Третьяков, 1985. С.20-29; Королев, Третьяков, 1990; 1991. С.55-71; Королев, 1995. С.191-205; 1996. С.113-147; Выборнов, Королев, 1995. С.110-123). Столь активная исследовательская деятельность привела к накоплению новых источников, их осмыслению и, что очень важно, достаточно быстрому введению в научный оборот.

Следует отметить выход в свет монографии Г.Н. Матюшина (Матюшин, 1982), в которой наряду с несомненными достоинствами (обширная публикация материалов первостепенных памятников), содержался и ряд недостатков, критически проанализированных в рецензии И.Б. Васильева, А.А. Выборнова, Н.Л. Моргуновой (Васильев, Выборнов, Моргунова, 1985. С.280-290). В 1985 году была опубликована совместная монография И.Б. Васильева и А.Т. Синюка (Васильев, Синюк, 1985). В монографии детально рассматриваются вопросы происхождения культур Восточной Европы от Приуралья до Поднепровья, их взаимодействия, периодизации и хронологии. Авторы отметили недостаточную включенность энеолита степи и лесостепи в учебные и фундаментальные издания. Совместное исследование И.Б. Васильева и А.Т. Синюка стало значительным вкладом в преодоление этого недостатка и решение ряда поставленных задач.

В конце 80-х гг. изучение энеолита на Нижней и Средней Волге вышло на новый уровень. Эта тенденция была подмечена И.Б. Васильевым. В статье, написанной им к 20-летию самарской археологии, подведены итоги исследований, констатировалось накопление необходимого фонда источников, открытие ряда археологических культур и культурных типов, построение общей периодизации. Кроме того, были поставлены новые задачи, решение которых возможно на новом источниковедческом и исследовательском уровне, комплексными работами с привлечением специалистов естественных наук, развитием направлений ориентированных на изучение истории гончарства и древней металлургии, широким радиоуглеродным датированием, применением статистических методов. И.Б. Васильев акцентировал внимание на необходимости тщательно планировать полевые работы в соответствии с исследовательской темой, не допуская немотивированных и дублирующих раскопок (Васильев, 1991. С.3-22).

Быстро растущий в течение предыдущих лет фонд источников требовал и определенного времени для обработки, теоретического осмысления, обобщений и публикации. Логичным завершением большой исследовательской работы в Северном Прикаспии стала конференция по проблемам изучения этого региона, организованная в 1990 г. в г. Куйбышеве. В четырех тематических сборниках научных трудов, посвященных вопросам изучения Северного Прикаспия в 1986, 1988, 1989, 1998 гг., были опубликованы материалы экспедиции. В 1992 г. П.П. Барынкин в ИА РАН защитил кандидатскую диссертацию «Энеолит и ранняя бронза Северного Прикаспия» (Барынкин, 1992).

Из печати вышел ряд крупных обобщающих работ. Событием стали монографически опубликованные в 1990 году материалы I Хвалынского могильника (Агапов, Васильев, Пестрикова, 1990). Изучение материалов этого ярчайшего памятника и хвалынской культуры в целом продолжалось и в последующее время. В.В. Ставицким в верховьях р. Суры на поселении Русское Труево I были получены хвалынские материалы.


С.35

Особенностью памятника стала связь керамики, кремневого и кварцитового инвентаря с жилищными котлованами (Ставицкий, 2001). Появление новых данных потребовало их включения в систему представлений о хвалынской культуре, пересмотру или уточнению ряда положений о культурно-хронологическом соотношении ее с другими культурами региона (Ставицкий, 2005. С.20-37). В 2008 г. Н.М. Маловым в обобщающей статье, наряду с историографией энеолита Нижней Волги был детально опубликован Хлопковский могильник (Малов, 2008. С.32-134). К проблемам происхождения, хронологии самарской и хвалынской культур, определению их места среди других энеолитических культур неоднократно возвращался И.Б. Васильев (Васильев, 2000. С.81-84; 2001. С.123-125; 2002. 63-72; 2003а. С.55-58; 2003б. С.72-75; 2003в. С.61-99; 2004. С.43-46). В 1995 г. вышла в свет монография Н.Л. Моргуновой, в которой были подведены итоги изучения неолита-энеолита в Волго-Уралье (Моргунова, 1995). Монография содержит характеристику хвалынских, самарских, токских, турганикских материалов, целый ряд ценных наблюдений, касающихся происхождения и соотношения культур и типов, периодизации и хронологии Волго-Уралья.

Вопросы изучения «воротничковой» керамики, происхождения, хронологического соотношения, периодизации и контактов степных культур Восточной Европы с учетом климатических условий той эпохи исследуются П.П. Барынкиным (Барынкин, 2001. С.38-40; 2003. С.47-60; 2004. С.35-38; 2006). Комплексный подход в исследовании древней истории степного-лесостепного Поволжья требовал изучения антропологии, особенностей хозяйства, керамического производства, каменной индустрии. Технологическим аспектам изготовления первобытной керамики энеолита степи-лесостепи посвящены труды И.Н. Васильевой. Исследуя керамические коллекции самарской (Васильева, 1999. С.191-216) и хвалынской (Васильева, 2002. С.15-49) культур, И.Н. Васильева приходит к выводам о трехкомпонентном, по крайней мере, составе коллекции керамики Съезженского могильника, об устойчивости гончарных традиций населения, оставившего I и II Хвалынские могильники, о наличии культурно-генетической близости гончарных традиций съезженского и хвалынского населения (Васильева, 2005. С.81-83).

Гетерогенность населения хвалынской культуры подтвердилась результатами изучения антропологического материала (Хохлов, 1998; Хохлов, Яблонский, 2000. С.278-307).

К характеристике памятников позднего энеолита обращается Н.В. Овчинникова. Она выдвигает предположение о прямом продвижении северных культур (волосовской, гаринской, новоильинской) на территорию лесостепи, связанном с ухудшением климата, и участии лесного населения в формировании лесостепных культур ранней и средней бронзы (Овчинникова, 1997; 2000; 2001. С.54-55; 2006. С.294-301). В отношении происхождения материалов «лесного облика» в лесостепном Поволжье отрабатывается и иная точка зрения, основанная на высказанных ранее предположениях И.Б. Васильева, Н.Л. Моргуновой, П.П. Барынкина, Е.В. Козина. Основываясь на типологических особенностях керамики Гундоровки, Чекалино IV и других памятников, степных аналогиях, радиоуглеродных определениях, предполагается хронологический приоритет лесостепных материалов, их формирование при участии степного населения, и дальнейшее участие в формировании лесных культур (Королев, 2008; Королев, Шалапинин, 2009. С.285-291).

Предметом специального изучения становится своеобразный тип керамики «с внутренним ребром», выявленный на Гундоровском поселении, стоянке Чекалино IV и ряде других, близкий турганикскому типу, но обладающий рядом специфических черт (Королев, Овчинникова, 2009; Королев, 2009. С.190-196). Следует отметить изучение специфических особенностей каменного инвентаря хвалынской культуры, проводимое И. В. Горащуком (Горащук, 2003. С.118-133; Горащук, Овчинникова, 2003. С.11-22). Некоторым вопросам изучения энеолита волго-уральского региона посвящена четвертая глава монографии С.В. Богданова (Богданов, 2004).

Результаты изучения самарскими (куйбышевскими) учеными эпохи энеолита включены в фундаментальные и учебные издания (Васильев, Матвеева, 1986; Археология. Неолит Северной Евразии, 1996; История Самарского Поволжья с древнейших времен до наших дней. Каменный век, 2000; Рындина, Дегтярева, 2002; Археология. Учебник, 2006; Древние культуры и этносы Самарского Поволжья, 2007; Археология Мордовского края. Каменный век, эпоха бронзы, 2008).


С.36

В 2010 году вышел один из двух томов фундаментального исследования по хвалынской культуре (Хвалынские энеолитические могильники …, 2010). В этом томе авторами дана характеристика I Хвалынского могильника как исторического источника (В.И. Пестрикова, С.А. Агапов), опубликованы результаты радиоуглеродной хронологии Хвалынских могильников (Е. Н. Черных, Л.Б. Орловская), результаты изучения керамики (П.П. Барынкин, И.Н. Васильева), металла (Е.Н. Черных, Н.В. Рындина, С.А. Агапов), каменного инвентаря (И.В. Горащук), антропологии (А.А. Хохлов, А.И. Нечволода), а также данные по археозоологии и украшениям. Выход в свет первого тома стал ярким событием в энеолитоведении Восточной Европы.

Масштаб полевых работ в 1990-2010 гг. на территории Самарской области уменьшился, акцент полевых работ был смещен за ее пределы. В 1997 г. в ходе раскопок Лебяжинского V поселения (Турецкий, 2000) было обнаружено два погребения мариупольского типа (Васильев, Овчинникова, 2000. С.219-220). В 2007 г. А.А. Выборновым (руководитель проекта), А.И. Королевым, А.Е. Мамоновым, А.А. Ластовским были проведены повторные комплексные исследования стоянки Чекалино IV (раскопки О.Д. Мочалова, 2007) с целью уточнения стратиграфического положения комплексов неолита-энеолита, отбора образцов на почвенный, палинологический, радиоуглеродный анализы. В экспедиции приняли участие кхн. Г.И. Зайцева, зав. радиоуглеродной лабораторией ИИМК РАН (Санкт-Петербург), ктн Н.Н. Ковалюх, зав. Радиоуглеродной лабораторией НАНУ (Киев), А.Н. Мазуркевич (куратор отдела археологии, Государственный Эрмитаж, Санкт-Петербург), дгн А.Л. Александровский, зав лабораторией почвоведения (Институт географии РАН, Москва), Н.В. Леонтьев (лаборатория ГИС, Институт географии РАН, Москва), проф.. дгн П.М. Долуханов (факультет исторических наук, университет г. Ньюкасла, Англия), д-р Грэм Сарсон и Кейт Дэвисон (факультет математики, университет г. Ньюкасла, Англия). Энеолитические материалы частично опубликованы (Королев, 2009. С.190-196; Королев, Шалапинин, 2009. С.285-291).

Начиная с середины 90 х гг. в СГПУ при неоценимой помощи и участии Н.М. Кудашкина сложился отряд экспедиции, ориентированный на изучение памятников неолита (А.А. Выборнов) и энеолита (А.И. Королев) контактных зон Среднего Поволжья, постоянными участниками которого становятся археологи из Пензы (В. В. Ставицкий) и Ульяновска (А.В. Вискалин). Были раскопаны памятники, содержащие энеолитические материалы: в 1995 г. Парат XII (Выборнов, Глущенко, Королев, 2000) и в 2000 г. Сутыри V (Вискалин, Выборнов, Королев, Ставицкий, 2004) в Марийском крае, в 1996 г. Волгапино (Королев, Ставицкий, 1998) и в 1998 г. Широмасово II (Королев, 1999б. С.106-115; Королев, Ставицкий, 2009) в Мордовии, в 1999 г. Ховрино в Ульяновской области (Вискалин, Выборнов, Королев, Ставицкий, 2002. С.58-80), в 2002 г. Городок I в Рязанской области (Выборнов, Королев, Ставицкий, Челяпов, 2007), в 2003 г. Кипец I в Тамбовской области (Выборнов, Королев, Ставицкий, 2005. С.15-34), в 2004 и 2005 гг. Озименки II и Усть-Кадада в Пензенской области. С 2006 года совместно с чебоксарскими археологами Н.С. Березиной, А.Ю. Березиным, директором краеведческого музея г. Алатыря А.В. Коноваленко, снс. ИА РАН В.В. Сидоровым проводится изучение памятников неолита – раннего металла в Алатырском районе Республики Чувашия (Березина, Вискалин, Выборнов, Королев, Ставицкий, 2007. С.14-23). Материалы экспедиции нашли отражение также в ряде обобщающих статей, в монографиях, диссертационных исследованиях: (Королев, 1999а; Ставицкий, 2006; Королев, Ставицкий, 2006; Археология Мордовского края …, 2008; Выборнов, 2008).

Следует отметить, что решение вопросов хронологии энеолитических культур и культурных типов долгое время затруднялось в связи с малым количеством абсолютных дат. В последнее время ситуация быстро меняется к лучшему и наряду с формированием банка радиоуглеродных дат по неолитическим материалам, идет накопление корпуса датировок и для эпохи энеолита (Моргунова, 2009. С.6-26; Королев, Шалапинин, 2010. С.256-259).

Подводя итоги обзора изучения энеолитической эпохи, необходимо подчеркнуть, что, несмотря на сравнительно короткую историю, самарскими археологами открыты и изучены многочисленные поселенческие и погребальные памятники этого времени как на территории Самарской области, так и за ее пределами.


С. 37

Выделены самарская и хвалынская энеолитические культуры, ряд культурных типов. Создана периодизация и хронология энеолита. Определено место энеолита средневолжской степи-лесостепи в системе представлений специалистов об этой эпохе в Восточной Европе.

Источники и литература
  • Агапов С.А., Васильев И.Б., Пестрикова В.И. Хвалынский могильник и его место в энеолите Восточной Европы // Археология Восточно-Европейской лесостепи. Воронеж, 1979.
  • Агапов С.А., Васильев И.Б., Пестрикова В.И. Хвалынский энеолитический могильник. Саратов, 1990.
  • Археология Мордовского края. Каменный век, эпоха бронзы. Саранск, 2008.
  • Археология. Неолит Северной Евразии. М., 1996.
  • Археология: Учебник / Под ред. акад. В.Л. Янина. М., 2006.
  • Барынкин П.П. Кызыл-Хак I – новый памятник позднего энеолита Северного Прикаспия (предварительная публикация) // Древние культуры Северного Прикаспия. Куйбышев, 1986.
  • Барынкин П.П. Энеолитический памятник Каир-Шак VI из южной части Волго-Уральского междуречья // Неолит и энеолит Северного Прикаспия. Куйбышев, 1989.
  • Барынкин П.П. Энеолит и ранняя бронза Северного Прикаспия. Автореф. дис. … канд. ист. наук. М., 1992.
  • Барынкин П.П. Поволжье и Южное Приуралье в период энеолита (к определению основных характеристик культурных процессов) // XV Уральское археологическое совещание. Тез. докл. междунар. конф. Оренбург, 2001.
  • Барынкин П.П. Северный Прикаспий в период энеолита и ранней бронзы // Вопросы археологии Поволжья. Вып.3. Самара, 2003.
  • Барынкин П.П. Степное Поволжье и Поднепровье в период энеолита (к проблеме культурогенеза и связей) // Проблемы археологии Нижнего Поволжья. Волгоград, 2004.
  • Барынкин П.П. Межкультурное взаимодействие населения степного Поволжья в эпоху энеолита // Проблемы этнокультурного взаимодействия в Урало-Поволжье: история и современность. Материалы межрегион. конф. Самара,2006.
  • Барынкин П.П., Васильев И.Б. Новые энеолитические памятники Северного Прикаспия // Археологические памятники на Европейской территории СССР. Воронеж, 1985.
  • Барынкин П.П., Васильев И.Б. Стоянка хвалынской энеолитической культуры Кара-Худук в Северном Прикаспии // Археологические культуры Северного Прикаспия. Куйбышев, 1988.
  • Барынкин П.П., Козин Е.В. Некоторые результаты исследований II Большераковской стоянки (о культурно-хронологическом соотношении материальных комплексов памятника) // Древности Восточно-Европейской лесостепи. Самара, 1991.
  • Барынкин П.П., Козин Е.В. Стоянка Лебяжинка I и некоторые вопросы соотношения нео-энеолитических культур в степном и южном лесостепном Заволжье // Древние культуры лесостепного Поволжья. Самара, 1995.
  • Бахарев С.С., Овчинникова Н.В. Чесноковская стоянка на реке Сок // Древности Восточно-Европейской лесостепи. Самара, 1991.
  • Березина Н.С., Вискалин А.В., Выборнов А.А., Королев А.И., Ставицкий В.В. Охранные раскопки многослойного поселения Утюж I на Суре // Самарский край в истории России. Вып.3. Самара, 2007.
  • Богданов С.В. Эпоха меди степного Приуралья. Екатеринбург, 2004.
  • Васильев И.Б. Южные районы лесостепного Поволжья в волосовское время // Лесная полоса Восточной Европы в волосовско-турбинское время. АЭМК. Вып.3. Йошкар-Ола, 1978.
  • Васильев И.Б. Лесостепное Поволжье в эпоху энеолита и ранней бронзы. Автореф. дис. … канд. ист. наук. М., 1979
  • Васильев И.Б. Энеолит лесостепного Поволжья // Энеолит Восточной Европы. Куйбышев, 1980.
  • Васильев И.Б. Энеолит Поволжья (степь и лесостепь). Куйбышев, 1981.
  • Васильев И.Б. Предисловие // Неолит и энеолит Северного Прикаспия. Куйбышев, 1989.
  • Васильев И. Б. Поздний энеолит юга лесостепного Поволжья // Энеолит лесного Урала и Поволжья. Ижевск, 1990.
  • Васильев И.Б. Некоторые итоги и задачи исследования первобытных памятников лесостепного Поволжья (к 20-летию самарской археологии) // Древности Восточно-Европейской лесостепи. Самара, 1991.
  • Васильев И.Б. Некоторые итоги изучения энеолита Волго-Уральской степи и лесостепи // Российская археология: достижения XX и перспективы XXI вв. Материалы конф. Ижевск, 2000.
  • Васильев И.Б. Хвалынская энеолитическая культура и сложение «классической» ямной культуры в волго-уральской степи и лесостепи // Бронзовый век Восточной Европы: характеристика культур, хронология, периодизация. Самара, 2001.
  • Васильев И.Б. Некоторые проблемные вопросы изучения хвалынской энеолитической культуры // Известия СНЦ РАН. Спец. выпуск. Современные вопросы истории и философии. Самара, 2002.
  • Васильев И. Б. Культурно-хронологическое соотношение мариупольских и хвалынских памятников в Поволжье // Чтения, посвященные 100-летию деятельности В.А. Городцова в Государственном Историческом музее. Тез. конф. Ч.1. М., 2003а.
  • Васильев И.Б. Некоторые проблемы исследования самарской энеолитической культуры в лесостепном Волго-Уралье // Международное (XVI Уральское) археологическое совещание. Материалы конф. Пермь, 2003б.
  • Васильев И.Б. Хвалынская энеолитическая культура Волго-Уральской степи и лесостепи (некоторые итоги исследования) // Вопросы археологии Поволжья. Вып.3. Самара, 2003в.
  • Васильев И.Б. Некоторые итоги исследования хвалынской энеолитической культуры // Проблемы археологии Нижнего Поволжья. Волгоград, 2004.
  • Васильев И.Б., Выборнов А.А. Нижнее Поволжье в эпоху камня и бронзы // Древняя и средневековая история Нижнего Поволжья. Саратов, 1986.
  • Васильев И. Б., Выборнов А.А., Габяшев Р.С., Моргунова Н.Л., Пенин Г.Г. Виловатовская стоянка в лесостепном Заволжье // Энеолит Восточной Европы. Куйбышев, 1980.
  • Васильев И.Б., Выборнов А.А., Моргунова Н.Л. Рецензия: Матюшин Г.Н. Энеолит Южного Урала. М., 1982 // СА. 1985. №2.
  • Васильев И.Б., Габяшев Р.С. Взаимоотношения энеолитических культур степного, лесостепного и лесного Поволжья и Прикамья // Волго-Уральская степь и лесостепь в эпоху раннего металла. Куйбышев, 1982.
  • Васильев И.Б., Иванов И.В. Взаимосвязь человека и природной среды в Северном Прикаспии // Проблемы эпохи неолита степной и лесостепной зоны Восточной Европы (тезисы докл.), Оренбург, 1986.
  • Васильев И.Б., Иванов И.В. Человек, природа и почвы Рын-песков Волго-Уральского междуречья в голоцене. М., 1995.
  • Васильев И.Б., Матвеева Г.И. Могильник у с. Съезжее на р. Самаре // СА. 1979. №4.
  • Васильев И. Б., Матвеева Г.И. У истоков истории Самарского Поволжья. Куйбышев, 1986.
  • Васильев И.Б., Овчинникова Н.В. Энеолит // История Самарского Поволжья с древнейших времен до наших дней. Каменный век. Самара, 2000.
  • Васильев И.Б., Пенин Г.Г. Елшанские стоянки на реке Самаре в Оренбургской области // Неолит и бронзовый век Поволжья и Приуралья. Куйбышев, 1977.
  • Васильев И.Б., Синюк А.Т. Черкасская стоянка на Среднем Дону // Эпоха меди юга Восточной Европы. Куйбышев, 1984.
  • Васильев И.Б., Синюк А.Т. Энеолит Восточно-Европейской лесостепи (вопросы происхождения и периодизации культур). Куйбышев, 1985.
  • Васильева И.Н. Технология керамики могильника у с. Съезжее // Археологические памятники Оренбуржья. Вып.III. Оренбург, 1999.
  • Васильева И.Н. О технологии керамики I Хвалынского энеолитического могильника // Вопросы археологии Поволжья. Вып.2. Самара, 2002.
  • Васильева И.Н. Сравнительный анализ технологии керамики Съезженского и I-II Хвалынских могильников // РА. 2005. №5.
  • Вискалин А.В., Выборнов А.А., Королев А.И., Ставицкий В.В. Поселение Ховрино в Посурье // Вопросы археологии Поволжья. Вып.2. Самара, 2002.
  • Вискалин А.В., Выборнов А.А., Королев А.И., Ставицкий В.В. Сутырское V поселение (раскопки 2000 года) // Взаимодействие культур в Среднем Поволжье в древности и средневековье. АЭМК. Вып.27. Йошкар-Ола, 2004.
  • Выборнов А.А. Шигоны II – новый памятник волосовского типа в Куйбышевской области // Проблемы эпохи энеолита степной и лесостепной полосы Восточной Европы. Тез. докл. Оренбург, 1980.
  • Выборнов А.А. Неолит Волго-Камья. Самара, 2008.
  • Выборнов А.А., Глущенко С.А., Королев А.И. Поселение волосовской культуры Парат XII в Марийском Поволжье // Исторические исследования. Вып.3. Самара, 2000.
  • Выборнов А.А., Елизаров А.Б., Овчинникова Н.В. Поселение Сауз II и проблема периодизации эпохи раннего металла Нижней Белой // Древности Среднего Поволжья. Куйбышев, 1985.
  • Выборнов А.А., Королев А.И. Поселение Имерка IV в Примокшанье // Древние культуры лесостепного Поволжья. Самара, 1995.
  • Выборнов А.А., Королев А.И., Ставицкий В.В. Поселение Кипец I в верховьях реки Вороны // Краеведческие записки. Вып.XII. Самара, 2005.
  • Выборнов А.А., Королев А.И., Ставицкий В.В., Челяпов В.П. Материалы позднего неолита-бронзы поселения Городок I // Верхнедонской археологический сборник. Вып.3. Липецк-СПб., 2007.
  • Выборнов А.А., Обыденнов М.Ф., Обыденнова Г.Т. Поселение Сауз I в устье реки Белой // Эпоха меди юга Восточной Европы. Куйбышев, 1984.
  • Выборнов А.А., Овчинникова Н.В. Итоги изучения поселения Сауз II (1980 г. ) // Древние и средневековые культуры Поволжья. Куйбышев, 1981.
  • Выборнов А.А., Третьяков В.П. Поселение Новый Усад IV на реке Мокше // Эпоха меди юга Восточной Европы. Куйбышев, 1984.
  • Выборнов А.А., Третьяков В.П. Поселение Имерка VI // КСИА. №185. 1986.
  • Выборнов А.А., Третьяков В.П. Стоянка Имерка III на реке Вад // Древности Среднего Поволжья. АЭМК. Вып.13. Йошкар-Ола, 1987.
  • Гольмстен В.В. Погребение из Криволучья // Сообщения ГАИМК. №6. Л., 1931.
  • Горащук И.В. Технология изготовления каменных орудий на стоянках хвалынской культуры // Вопросы археологии Поволжья. Вып.3. Самара, 2003.
  • Горащук И.В., Овчинникова Н.В. Каменный инвентарь хвалынской культуры Гундоровского поселения // Краеведческие записки. Вып.XI. Самара, 2003.
  • Древние культуры и этносы Самарского Поволжья. Самара, 2007.
  • Дубягин П. С., Чикризов Ф.Д., Чуринов В.А., Васильев И.Б., Выборнов А.А. Новые материалы неолита-бронзы из Северного Прикаспия // Волго-Уральская степь и лесостепь в эпоху раннего металла. Куйбышев, 1982.
  • Королев А.И. Поселение волосовской культуры Имерка I-Б на реке Вад (некоторые итоги исследования) // Древние культуры лесостепного Поволжья. Самара, 1995.
  • Королев А.И. Многослойное поселение Имерка 8 на реке Вад // Историко-археологические изыскания. Вып.1. Самара, 1996.
  • Королев А.И. Энеолит Примокшанья и Верхнего Посурья. Автореф. дис. … канд. ист. наук. Ижевск, 1999а.
  • Королев А.И. Материалы по хронологии энеолита Примокшанья // Вопросы археологии Поволжья. Вып.1. Самара, 1999б.
  • Королев А.И. Актуальные вопросы изучения энеолита лесостепного Поволжья // Известия СНЦ РАН. Т.10. №4 (26). Самара, 2008.
  • Королев А.И. Актуальные вопросы изучения керамики «с внутренним ребром» // Проблемы изучения культур раннего бронзового века степной зоны Восточной Европы. Оренбург, 2009.
  • Королев А.И., Овчинникова Н.В. К вопросу о культурно-хронологической принадлежности керамики «с внутренним ребром» с поселений Самарского Поволжья // Тверской археологический сборник. Вып.7. Тверь, 2009.
  • Королев А.И., Ставицкий В.В. Поселение Волгапино на реке Мокше // Исторические исследования. Вып.2. Самара, 1998.
  • Королев А.И., Ставицкий В.В. Примокшанье в эпоху раннего металла. Пенза, 2006.
  • Королев А.И., Ставицкий В.В. Поселение и могильник эпохи раннего металла у с.Широмасово // Древности Окско-Сурского междуречья. Вып.3. Саранск, 2009.
  • Королев А.И., Третьяков В.П. Энеолитические памятники Примокшанья // Энеолит лесного Урала и Поволжья. Ижевск, 1990.
  • Королев А.И., Третьяков В.П. Поселение Новый Усад IV в Мордовии // Древности Восточно-Европейской лесостепи. Самара, 1991.
  • Королев А. И., Шалапинин А.А. Об одной группе гундоровской керамики: новый взгляд на волосовскую коллекцию // Археология Восточноевропейской лесостепи. Сб. материалов II междунар. науч. конф. Вып.2. Т.I. Пенза, 2008.
  • Королев А.И., Шалапинин А.А. Керамика третьей группы стоянки Чекалино IV и проблемы взаимодействия населения лесостепи и леса в позднем энеолите // Известия СНЦ РАН. Т.11. №6. Самара, 2009.
  • Королев А.И., Шалапинин А.А. Радиоуглеродное датирование ранних материалов волосовской культуры Среднего Поволжья // Известия СНЦ РАН. Т.12. №2 (34). Самара, 2010.
  • Лаврушин Ю.А., Спиридонова Е.А., Сулержицкий Л.Д. Геолого-палеоэкологические события севера аридной зоны в последние 10 тыс. лет // Проблемы древней истории Северного Прикаспия. Самара, 1998.
  • Малов Н.М. Хлопковский могильник и его место в энеолите Поволжья (по материалам раскопок 1977-1978 гг.) // Волго-Уральская степь и лесостепь эпоху раннего металла. Куйбышев, 1982.
  • Малов Н.М. Хлопковский могильник и историография энеолита Нижнего Поволжья // Археология Восточно-Европейской степи. Вып.6. Саратов, 2008.
  • Матюшин Г.Н. Энеолит Южного Урала. М., 1982.
  • Мелентьев А.Н. О возникновении скотоводства в евразийских степях // Проблемы эпохи энеолита степной и лесостепной полосы Восточной Европы. Тез. докл. Оренбург, 1980.
  • Моргунова Н.Л. Ивановская дюна на реке Ток в Оренбургской области // Древняя история Поволжья. Куйбышев, 1979.
  • Моргунова Н.Л. Ивановская стоянка эпохи энеолита-энеолита в Оренбургской области // Энеолит Восточной Европы. Куйбышев, 1980.
  • Моргунова Н.Л. Турганикская стоянка и некоторые проблемы самарской культуры // Эпоха меди юга Восточной Европы. Куйбышев, 1984.
  • Моргунова Н.Л. Энеолитические комплексы Ивановской стоянки // Неолит и энеолит Северного Прикаспия. Куйбышев, 1989.
  • Моргунова Н.Л. Неолит и энеолит юга лесостепи Волго-Уральского междуречья. Оренбург, 1995.
  • Моргунова Н.Л. Хронология и периодизация энеолита Волжско-Уральского междуречья в свете радиоуглеродного датирования // Проблемы изучения культур раннего бронзового века степной зоны Восточной Европы. Оренбург 2009.
  • Овчинникова Н.В. Керамика волосовского типа с Гундоровского поселения // Поздний энеолит и культуры ранней бронзы лесной полосы Европейской части России. Йошкар-Ола, 1990.
  • Овчинникова Н.В. Лебяжинка III – поселение эпохи энеолита в лесостепном Заволжье // Древние культуры лесостепного Поволжья. Самара, 1995.
  • Овчинникова Н.В. Хронология и периодизация энеолитических древностей в лесостепном Поволжье // Древности Волго-Донских степей в системе восточноевропейского бронзового века. Волгоград, 1996.
  • Овчинникова Н. В. К вопросу о причинах миграций лесных племен в лесостепную зону в эпоху энеолита // Природа и цивилизация. Реки и культуры. СПб, 1997.
  • Овчинникова Н.В. Волосовские древности юга лесостепного Поволжья // Тверской археологический сборник. Вып.4. Т.1. Тверь, 2000.
  • Овчинникова Н.В. Памятники позднего энеолита в лесостепном Поволжье // XV Уральское археологическое совещание. Тез. докл. междунар. конф. Оренбург, 2001.
  • Овчинникова Н.В. Итоги изучения энеолитических поселений лесостепного Поволжья // Известия СНЦ РАН. Спец. вып. Актуальные проблемы истории, археологии, этнографии. Самара, 2006.
  • Овчинникова Н.В., Хохлов А.А. Исследование грунтового могильника у с.Гундоровка в лесостепном Поволжье // Тверской археологический сборник. Вып.3. Тверь, 1998.
  • Пенин Г.Г. Новые неолитические памятники на реке Самаре в Оренбургской области // Проблемы археологии Поволжья и Приуралья. Куйбышев, 1976.
  • Пестрикова В.И. Хвалынский энеолитический могильник как исторический источник. Автореф. дис. … канд. ист. наук. М., 1987.
  • Рындина Н.В., Дегтярева А.Д. Энеолит и бронзовый век: учебное пособие. М., 2002.
  • Ставицкий В.В. Энеолитическое поселение Русское Труево I на Верхней Суре // Археологические памятники Оренбуржья. Вып.V. Оренбург, 2001.
  • Ставицкий В.В. Проблемные вопросы изучения хвалынской энеолитической культуры // II Городцовские чтения. Материалы конф. М., 2005.
  • Ставицкий В.В. Неолит, энеолит и ранний бронзовый век Сурско-Окского междуречья и Верхнего Прихоперья: Динамика взаимодействия культур севера и юга в лесостепной зоне. Автореф. дис. … докт. ист. наук. Ижевск, 2006.
  • Третьяков В.П. Поселения Имерка 1-Б и Имерка 5 в Мордовии // Древности Среднего Поволжья. Куйбышев, 1985.
  • Турецкий М. А. Отчет о раскопках поселения Лебяжинка V в Красноярском районе Самарской области в 1997 г. Самара, 2000 // Архив ИА РАН. Р-1. №24112-24117.
  • Хвалынские энеолитические могильники и хвалынская энеолитическая культура. Исследования материалов. Т.2 / Составитель и научный редактор С.А. Агапов. Самара, 2010.
  • Хохлов А.А. Палеоантропология пограничья лесостепи и степи Волго-Уралья в эпохи неолита-бронзы. Автореф. дис. … канд. ист. наук. М., 1998.
  • Хохлов А.А., Яблонский Л.Т. Палеоантропология Волго-Уральского региона эпохи неолита-энеолита // История Самарского Поволжья с древнейших времен до наших дней. Каменный век. Самара, 2000.
  • Яблонский Л.Т. К антропологии древнейшего населения Прикаспия // Проблемы эпохи неолита степной и лесостепной зоны Восточной Европы (тезисы докл.). Оренбург, 1986а.
  • Яблонский Л.Т. Антропология раннеэнеолитического населения Прикаспия // Древние культуры Северного Прикаспия. Куйбышев, 1986б.

ЗАЛ 4. РАСПАД ПЕРВОБЫТНОЙ ОБЩИНЫ. ЭНЕОЛИТ ЮГА. БРОНЗОВЫЙ ВЕК. (4 — 2 ТЫСЯЧЕЛЕТИЯ ДО Н.Э.)

В энеолите и бронзовом веке происходит прогрессирующее развитие всех отраслей хозяйственной деятельности человека, сопровождающиеся изменениями в структуре общества и сложными этнокультурными процессами.
В энеолите (медно-каменный век) появляются первые изделия из чистой меди, а в бронзовом веке распространяются искусственные сплавы на медной основе, позволяющие получить новый металл – бронзу.
Преимущество бронзы перед медью заключается в более низких температурах плавления, что способствовало широкому распространению металлургии бронзы. Кроме того, бронзовые орудия по техническим качествам превосходят орудия из чистой меди – они тверже и острее.
Усиливается неравномерность социально-экономического развития древних обществ в разных регионах. Зависимость этого процесса от природно-климатических условий теперь дополняется такими факторами как близость к меднорудным месторождениям и центрам древних цивилизаций, поэтому в южных и северных районах развитие человеческого общества шло разными направлениями и темпами.
На юге Евразии продолжало совершенствоваться производящее хозяйство. На плодородных землях долин крупных рек Кавказа и юго-запада Восточной Европы развивались раннеземледельческие общества. В это же время в степном поясе Евразии возникают обширные историко-культурные общности, в производящем хозяйстве которых преобладало скотоводство. Здесь происходило одомашнивание лошадей и постепенно складывалось кочевое хозяйство, ставшее ведущим для населения этого региона на несколько последующих тысячелетий.
Значительное повышение уровня развития производительных сил усилило социальное и имущественное расслоение населения, что привело к выделению и обогащению племенной верхушки.
Зона распространения производящего хозяйства и металла продвигалась в лесную зону Евразии. Однако здесь длительное время сохранялись пережитки неолитических традиций, а в отдельных районах до конца эпохи бронзы продолжалось использование каменных орудий.
На большей части территории лесной зоны в эпоху бронзы сложилось комплексное хозяйство, в котором сочетались производящие и присваивающие отрасли. В одних района они были равны по своему значению, в других большую роль продолжали иметь охота и рыбная ловля. В районах с особо благоприятными условиями для развития присваивающего хозяйства оно стало по количеству производимого продукта высокоэффективным аналогом производящего хозяйства.
Эпоха бронзы отличалась бурными событиями, сопровождающимися передвижениями больших массивов людей, военными столкновениями, возникновением и распадом огромных этнокультурных общностей. В Восточноевропейских степях происходило формирование индоевропейской языковой общности. К концу эпохи бронзы эти районы были заняты индоиранскими, а северные лесные и отчасти лесостепные – в основном финно-угорскими племенами.

Медно-каменный век — Русский Север

Поздний неолит и энеолит приходятся на суббореальную эпоху (2,7-0,5 тыс. лет до н.э.) с теплым и сухим климатом. Правда, временами имели место значительные отклонения от средних значений. В береговых склонах Онежского озера выделяются три промежуточных уровня, отражающих его колебания как следствие трансгрессий и регрессий. Наиболее длительной и сильной была раннесуббореальная трансгрессия (2,7-2 тыс. лет до н.э.). Тогда же усилилась влажность — осадков выпадало пример­но на 100 мм больше, чем сейчас. Средняя температура понизилась и стала более чем на 2 градуса ниже современной.

В середине суббореала (2-1,3 тыс. лет до н.э.) установился в основном сухой и теплый климат. Среднегодовая температура на 2-2,5 градуса превышала современ­ную, а осадков выпадало на 50-100 мм меньше. Около 2 тыс. лет до н.э., по данным Э. И. Девятовой, климат стал экстремально сухим. Пересохло даже русло многовод­ной реки Выг, одной из крупнейших в Карелии. Маловодный период достигает мак­симума около 1,5-1,4 тыс. лет до н.э. В целом климат отличался от современного мягкими зимами и более теплым продолжительным летом.

Растительный мир суббореала характеризуется большим разнообразием темно-хвойных и светлохвойных пород в сочетании с мелколиственными на местах пожа­рищ. Раннесуббореальное похолодание уменьшило примесь широколиственных по­род. На некоторое время доминирующими стали березовые, осиново-березовые и сероольховые леса. Во второй половине суббореала, видимо, слегка преобладали светлохвойные. В конце суббореала, при максимуме сухости, произошло смещение при­родных зон к югу, а в целом природные условия приблизились к современной средне-таежной зоне. Колебания уровня Онежского озера доходили до 1,5-2 м.

Отклонения в погодных условиях, особенно сильные засухи время от времени при­водили к пожарам, уничтожавшим или изреживавшим леса на обширных территори­ях. Первобытную тайгу называют «гарью на разных стадиях восстановления». На месте пожарищ появлялись вторичные леса с преобладанием березы, примесью оси­ны и ольхи. Наводнения, пожары, штормы и ураганы, землетрясения и другие сти­хийные бедствия осложняли жизнь первобытных людей, усиливали чувства страха и незащищенности, побуждали менять места обитания.

В суббореале на смену каменному веку приходит энеолит, или медно-каменный век. Основной его признак — появление медных изделий16. Но кардинальных измене­ний в хозяйстве и образе жизни населения еще не произошло. По-прежнему домини­ровали орудия труда из камня, кости и дерева. Основными занятиями остаются охота и рыболовство. Тем не менее знакомство с самородной медью является важным собы­тием. Оно произошло в Карелии довольно рано и, видимо, самостоятельно. В резуль­тате со временем здесь возник свой очаг металлообработки, правда, гораздо более скромный по масштабам, объему производства и уровню технологии, чем гаринско-борский или волосовский в Приуралье и Поволжье.

Переходный период от позднего неолита к энеолиту связан с культурой ромбо-ямочной керамики, существовавшей в середине — второй половине III тысячелетия до н.э. Всего к настоящему времени известно более 200 памятников с такой керами­кой, чаще встречающихся по берегам рек, чем озер. Их много в бассейне Онежского озера. Площадь поселений от 200 до 10000 кв. м. Обычно они вытянуты узкой поло­сой вдоль берега. Большинство имеет наслоения других периодов. Типичными можно считать поселения Вигайнаволок I под Петрозаводском и Пегрема I и III в Заонежье17.

Жилища (всего их раскопано около 30) располагаются неподалеку друг от друга в одну или две линии, обычно в междувальях — естественных углублениях между сгла­женными прибрежными валами, что и предопределило их ориентировку. Они прямо­угольные в плане, площадью от 16 до 100 кв. м, с коридорообразными выходами дли­ной до 2 м при ширине 1,5-2 м, чаще всего в сторону водоема. Судя по углистым или темным гумусированным полосам, стены состояли из горизонтально положенных бревен. Следы столбов у стен отсутствуют, но изредка ямки от столбов встречаются в центре. Конструкция стен и кровли не вполне ясна. Площадка пола углублена в зем­лю на 0,1-0,5 м. На полу находили многочисленные черепки   сосудов, сланцевые орудия, обломки глиняных скульптурок, медные изделия. Очаги размещались или по центру жилища, или у выхода. Иногда два или даже три жилища соединялись коридо­ром, образуя жилые комплексы (Вигайнаволок I). Очертания большинства из них приближаются к квадратным и только примерно треть — прямоугольные. Выделяют большие  жилища с длиной  стен 7-10 м, средние — 5-7 м и малые — 3,5-5 м.

На стоянке Пегрема I обнаружены следы наземной постройки, в центральной ча­сти которой вскрыта печь в виде ящика из квадратных плит размером 0,4 х 0,4 х 0,25 м, а рядом — следы глиняной обмазки, обломки медных изделий и меди, фрагмент ошлакованного тигелька, фрагменты керамики с каплями расплавленной меди. Прав­да, возраст данного объекта не вполне ясен.

Очаги, как и в позднем неолите, двух типов: углистые линзы с одним или несколь­кими камнями и кладки округлой формы из 30-50 камней, обычно на углистом слое. Встречались каменные кладки из валунов и гальки и без следов огня, а также ямы, заполненные охристым или углистым песком. На стоянке Пегрема XXII за пределами жилища зарыты впрок большие куски глины. Преобладают временные летние стоян­ки, не имеющие жилищ, представленные повсеместно. Могильники пока не известны.

Среди более 2000 выделенных сосудов имеются небольшие, почти миниатюрные чашечки — 5-10 см в диаметре (не более 3-10%), сосуды средних размеров- 10- 25 см (гораздо более распространенные) и большие — 25-45 см в диаметре (составля­ющие не менее половины общего числа). Преобладают непрофилированные, полуяй­цевидные круглодонные формы. Крайне редко и только на более поздних памятниках попадались слегка профилированные сосуды с уплощенным или плоским днищем. Обжиг хороший или средний. Внутренняя, а иногда и внешняя сторона обработаны расчесами гребенчатого штампа.

Сосуды чаще толстостенные — 0,8-1 см. Венчики, как правило, утолщены, ско­шены внутрь и орнаментированы. Изредка они оформлены защипами пальцев. Орнамент обычно представляет собой сплошной узор из ромбических или овальных ямок, расставленных в шахматном порядке. Встречался разреженный узор из крупных ром­бических или круглых ямок. Зоны (пояса) ямок чередуются с полосками гребенчатых штампов, оттисками веревочки, отступающей лопаточки, создавая горизонтально-зональное членение орнаментального поля. Сравнительно немного сосудов с геомет­рическими узорами.

Каменный инвентарь в значительной степени унаследован от предыдущего пе­риода. Правда, набор его стал несколько шире, а обработка сланцевых орудий до­стигла совершенства. Они, как правило, зашлифованы по всей поверхности. По-пре­жнему использовались кварц, лидит и привозной кремень (поселения Деревянное I, Илекса I, Колгостров I, Вигайнаволок I, Черная Губа 1 и др.).

В сланцевых рубящих орудиях выделяются топоры овальные и прямоугольные в плане и поперечном сечении. Большинство тесел прямоугольные; стамески прямо­угольные или трапециевидные. Характерны немногочисленные желобчатые долота, киркообразные орудия, ромбовидные «клевцы» с отверстием в центре, крупные от­бойники и кайла (для пробивания льда).

Среди скребущих и режущих орудий преобладают скребки из отщепов прямо­угольной, изредка округлой формы. Наконечников стрел мало, они листовидной и ромбической формы. Найдены части составных рыболовных крючков в виде рыбок (4 экз). Из украшений выделим подвески с просверленными отверстиями, кольца и их заготовки в виде слегка обработанных сланцевых дисков.

К самородной меди, вероятно, относились как к разновидности камня. Вкрапле­ния ее на Заонежском полуострове приурочены к кварцевым жилам и обнаружива­лись, видимо, при поисках и заготовке кварца. На данном этапе самородную медь обрабатывали только методом холодной ковки. Изделий из меди найдено немного: нож, проколки, кольца, пластинки, поделки неясного назначения. Попадались кусоч­ки самородной меди и отходы производства. Плавление, горячая ковка, термическая обработка — все эти технологии распространились позднее, на поселениях с асбесто­вой керамикой. И только теперь можно с полным основанием говорить о переходе к эпохе раннего металла.

Национальный музей Республики Карелия

В экспозиции представлены материалы археологических исследований: инвентарь самой древней стоянки на территории Карелии, орудия труда из мастерских по обработке камня, восстановленные неолитические сосуды, предметы культа и амулеты из погребений известного Оленеостровского могильника, уникальные артефакты – гранитные плиты с таинственными наскальными рисунками (петроглифами) с восточного берега Онежского озера.

Могильник на Южном Оленьем острове Онежского озера (VI тыс. до н.э.) – самый большой и уникальный погребальный памятник эпохи мезолита в Европе, был исследован в 1936–1938 гг. археологом В.И. Равдоникасом . Во время раскопок было найдено 177 погребений, в которых сохранились костные останки, оригинальные орудия охоты и рыболовства, украшения и предметы культа из камня, кости и рога (7132 предмета).

Эпоха мезолита на территории Карелии датируется VII–V тыс. до н.э. В настоящее время открыто более 300 мезолитических кратковременных стоянок, долговременных поселений с остатками жилищ-полуземлянок, мастерских по добыче каменного сырья и изготовления орудий. Основные находки – это изделия и отходы производства из камня. В эпоху мезолита были освоены основные каменные индустрии – кварцевая, сланцевая, кремнёвая. Основными занятиями были таёжная охота и озёрное рыболовство.

Эпоха неолита на территории Карелии датируется V–III тыс. до н.э. Освоение производства керамики, совершенствование кремневой и сланцевой индустрий – основные ступени технологического прогресса в этот период. В неолите отмечены резкий рост численности коллективов, развитие социальных отношений. В Карелии выделяются археологические культуры с керамиками сперрингс, сяряйсниеми I, ямочно-гребенчатой и гребенчато-ямочной.

Эпоха раннего металла (начало III – середина I тыс. до н.э.) включает два периода – энеолит и бронзовый век и связана с началом производства цветных металлов. Человек освоил обработку меди и производство бронзы. Энеолит – это памятники с ромбоямочной и асбестовой керамиками, бронзовый век – с сетчатой керамикой. Большие человеческие коллективы жили в больших жилищах – полуземлянках. Основой хозяйства были охота на лесного и морского зверя, рыболовство. Племена с сетчатой керамикой пришли в Карелию с юго-востока.

 

археолог Анна Мосунова – о погребениях эпохи энеолита — Свердловский областной краеведческий музей имени О.

Е. Клера

С конца марта по 20 апреля коллектив Свердловского областного краеведческого музея работает удаленно – в отрыве от своих зданий, экспозиций и коллекций. Мы попросили сотрудников отделов истории и археологии рассказать о своих любимых предметах из собрания СОКМ – тех, что входят в сферу их научного интереса и по которым они особенно скучают.

О погребальных комплексах из экспозиции Музея истории и археологии Урала  рассказывает научный сотрудник Отдела древней истории народов Урала Анна Мосунова.

Прошло немало времени, прежде чем человек пришел к привычному для современных людей способу хоронить своих умерших в земле. Самые ранние такие погребения относятся к мустьерской эпохе. Очевидно, что предоставить тело воздействию естественных природных процессов значительно менее трудозатратно, чем копать могильную яму. Возможно, первобытный человек выбрал именно такой сложный процесс в соотвествии со своими мифологическими и религиозными представлениями, осознанно осмысляя вопросы жизни и смерти. Тогда и возникли первые образы потустороннего мира.

Конец IV – III тысячелетие до н. э. на Урале археологи традиционно позиционируют как эпоху энеолита (медно-каменного века). Это время благоприятных природных условий, демографического роста, появления общих культурных традиций на обширной территории от Урала до севера Казахстанских степей (об этом говорят связи, близкие керамические традиции, детали костюма). В это время формируются многие феномены, которые найдут продолжение в эпоху бронзы. Один из таких феноменов связан с традицией погребальной обрядности и появлением первых для Зауралья намеренных грунтовых погребений. Речь идет о погребальных комплексах, расположенных в средней полосе горнолесного Зауралья, то есть там, где мы с вами сейчас проживаем. С двумя из них можно познакомиться в экспозиции Музея истории и археологии Урала.

Первый комплекс обнаружил в 1988 году Юрий Борисович Сериков в гроте Камень Дождевой на реке Чусовой. В расселине скалы на высоте 14 метров над водой оказалось два погребения. Первое, сразу за входом в грот, было сильно разрушено. По определению физических антропологов, кости принадлежали женщине 35–40 лет. Она лежала на спине, в вытянутом положении, головой на северо-восток, в неглубокой яме, засыпанной красной охрой. из погребального инвентаря – каменный скребок и фрагмент сосуда. Одежда погребенной была богато расшита просверленными зубами животных. Клыки были нашиты у бедер, вокруг колен, в области лодыжек и кистей рук и принадлежали в большинстве своем выдре, несколько – лисице, северному оленю и медведю.

Глубже в гроте находилось второе погребение – мужчины 40–45 лет. Он лежал на спине в скорченном положении, в неглубокой яме, дно которой было так же посыпано охрой. В ногах зафиксировали скопление рыбьих костей и чешуи (щуки, окуня, карповых, лососевых). На нем была шапка с меховой оторочкой с нашитым на нее клыком лисицы, кожаные брюки, куртка и меховые сапоги. На брюках – костяные подвески (с внутренней стороны – овальные, с внешней – в виде уточек). Широкий пояс расшит резцами бобра. Под руками на поясе находился костяной гарпун, на груди – каменный шлифованный нож. Слева на поясе, по всей видимости, была сумка с каменными орудиями и заготовками. Также в могиле нашли наконечники стрел и фрагменты двух сосудов.

Во время раскопок Аятского поселения в 1956–1959 годов археолог Елизавета Михайловна Берс обнаружила погребение, совершенное в могильной яме рядом со стенкой энеолитического жилища. В данном случае ритуал подразумевал первоначальное отделение головы погребенного (в подобных случаях голову, вероятно, сжигали в очаге жилища). Возможно, тело, предварительно уложили на деревянный настил, сооруженный над дном могилы, который по мере прогорания провалился в яму. Скелет лежат вытянуто на спине с руками, вытянутыми вдоль туловища, и ориентирован головой на северо-восток. Его засыпали толстым слоем охры, над которым разводили костер. Погребальный инвентарь находился над костяком в слое охры. Лишь некоторые предметы лежали на уровне ключиц и тазовых костей скелета. Среди погребального инвентаря оказались подвески из яшмы, преимущественно, круглые, с дырочками для подвешивания и мелкими резными зубчиками по краю, подвески из кости, овальные и полированные. В области груди найдена костяная бляха или пуговица диаметром 3,5 см с зубчиками по краю и отверстием в центре. Вторая бляха диаметром 8 см из зеленокаменной породы, со сверленым отверстием в центре, была заполирована до блеска. Также ахреологи нашли скребок, сделанный на ножевидной кремневой пластине, и две пилки на отщепах с ретушью. Все вещи были будто нарочно обломаны. На месте сердца лежала пластинка слюды размером 12–15 см, которая дает зеркальное отражение. Помимо этого, могилу заполняли  скребки, несколько наконечников стрел и отщеп из горного хрусталя. При раскопках на дне могилы увидели ямки от столбов: их расположение и позволяет предполагать, что над дном ямы на невысоких столбиках стоял настил.

Погребальный обряд всегда отражает складывавшуюся тысячелетиями целостную систему взглядов, связанных как с религиозными и мифологическими воззрениями общества, так и с его социальной организацией. Попытки расшифровать символику погребального обряда обычно наиболее проблематичны и спорны в археологии. Еще более спорны интерпретации погребальной обрядности в период ее выработки и становления как явления, когда традиция еще не стала устойчивой.

И все же можно проследить общие черты погребений на большой территории, включающей горнолесное Зауралье. Образ жизни обществ охотников и рыболовов эпохи энеолита в этом регионе был схож, в отличие от образа жизни соседствующего по другую сторону хребта населения Волго-Уральских степей и населения лесостепей Южного Урала. Некоторые исследователи отмечают, что нет существенных различий в погребальной обрядности населения по разные стороны Уральского хребта – этот факт иллюстрирует близкие культурные связи. Однако на погребальный обряд жителей Приуралья влияли, прежде всего, традиции западного населения. На Южном Урале и в Приуралье также прослеживается влияние скотоводческих культур, и рититуальные практики этой территории отражают иную стратегию жизнеобеспечения, присущую скотоводам. Обрядность же населения горнолесного Зауралья более сходна с традициями Западной Сибири.

Отметим наиболее характерные из черт. Большинство погребений горнолесного Зауралья – одиночные либо состоят из захоронений двух–трех человек в одной могиле. Некрополи как таковые встречаются в Тюменском Притоболье или, наоборот, в таежной зоне севера Западной Сибири, но в меньших масштабах. Во многих случаях захоронения находятся на территории поселений, рядом с ними или в покинутых жилищах. Среди них выделяются захоронения без черепов или, наоборот, отдельных черепов. Для горнолесного Зауралья также характерны захоронения в пещерах, гротах, каменных ящиках, что, по мнению некоторых авторов, можно отнести к наиболее раннему этапу развития местного погребального обряда. Целые сосуды, как правило, отсутствуют, вместо них в  могилы преднамеренно помещают фрагменты керамики. Знаковый атрибут – украшения в виде костяных и каменных подвесок каплевидной и округлой формы, а также наконечники стрел, в том числе шлифованные с желобком и «рыбковидной» формы. Почти всегда есть подсыпка охрой. Сопутствующий инвентарь (без целых сосудов, но с отдельными фрагментами и намеренно сломанными наконечниками стрел) говорит о намеренной порче вещей в ходе ритуальных действий. В разной степени использовали огонь: иногда проводили полную и частичную кремацию, разводя костер над могилой или на надмогильном сооружении, иногда покойного кремировали на стороне, затем размещая прах в могиле. На некрополях иногда совмещали обряды погребения и кремации. Положение умершего в большинстве случаев вытянуто на спине, головой в северный сектор.

Познакомьтесь с другими рассказами из цикла «Личное дело»: 

Историк Константин Аникин – о сабле «Фрегат «Светлана»

Историк Николай Неуймин – о картине «Дом Ипатьева»

Хотите больше историй об интересных экспонатах? Следите за рубрикой «Предметные истории» на YouTube-канале музея!

Темы новости:
Блог, Личное дело, Музей, Музей истории и археологии Урала, Наши сотрудники

Энеолит – медно-бронзовый век

Ранний средний бронзовый век в Европе. Источник изображения: www.eupedia.com/europe/Haplogroup_R1b_Y-DNA.shtml

Постоянно ища материал, который был необходим для производства инструментов и оружия, человек случайно нашел металл. Это была медь. С открытием этого металла произошли серьезные изменения в образе жизни людей того времени. Во-первых, имели место крупные перемещения населения, известные как индоевропейские миграции .Произошло это в третьем тысячелетии до нашей эры, когда на территорию евразийских степей решили переселиться многочисленные племена. Одна группа двигалась на запад по европейскому континенту, другая группа двигалась на восток в Персию и Индию, а третья группа двигалась на юг, в район современного Ближнего Востока и Египта. Оккупанты упомянутого района были очень хорошо организованы, особенно военные.

У них было оружие, сделанное из металла, и обычно в своих завоеваниях они использовали также лошадей.

Энеолит — первая или начальная стадия железного века . Это период, когда люди начали использовать металл, то есть медь, как новый материал для изготовления инструментов, оружия и других различных артефактов. Предметы из меди, по сравнению с предметами из камня, были намного проще, удобнее в использовании и служили дольше. Однако плохое распределение металла является его огромным и существенным недостатком. Медь, как правило, находили в поверхностном слое земли, но лишь в небольших количествах.

Оружие эпохи энеолита

При обработке некоторых кусков меди в первую очередь обращали внимание на ее мягкость, что было важным свойством при конструировании инструментов и оружия. Ударив кувалдой по твердой меди, он стал плоским, а его концы стали намного острее, чем у каменных предметов. Этот способ обработки меди называется ковкой , и это на самом деле самый старый метод в разработке инструментов и оружия, которые изготавливаются из металла.Со временем люди заметили, что медь при сильном нагреве начинает плавиться, и поэтому стали использовать ее, заливая и изготавливая таким образом различные инструменты. Расплавленную медь заливали в уже подготовленные глиняные формы . По сути, это установило новый способ обработки меди или металла, известный как литье . Колыбелью этого металла является район Средней Азии. Со временем, особенно в начале IV тысячелетия до н.э., литье из меди было перенесено в долину реки Нил, а затем и во многие другие районы мира.

Преимуществом меди по отношению к камням была ее мягкость. Медь легко поддавалась обработке, но, с другой стороны, ее плохая способность плавиться представляла его большой недостаток. Поэтому у меди не было особого назначения для изготовления инструментов и оружия. Люди больше использовали его для создания разнообразных украшений, украшений, шильев, кинжалов, ножей и т. д. Поэтому камни по-прежнему представляли собой основной материал для изготовления орудий труда, особенно более тяжелых и массивных, которые были необходимы для выживания человек и его постоянная борьба с природой.

Ювелирные изделия бронзового века

Вытеснение камня из повседневного обихода и увеличение использования металла произошло после того, как человек успешно сплавил медь со свинцом , цинком или сурьмой и получил бронзу . Бронза была новым материалом, который гораздо тверже и относительно легко расплавлялся . Однако даже бронза не вытеснила полностью камень, хотя использование бронзы в изготовлении инструментов, оружия, украшений и других предметов со временем, действительно, получило широкое распространение.Это было сделано только с изобретением железа.

В середине третьего тысячелетия до нашей эры начался бронзовый век . Родиной бронзового века является южный Иран и Месопотамия. Позже использование бронзы распространилось на территорию Малой Азии между I и II тысячелетиями до н.э. Затем во II тысячелетии до нашей эры использование бронзы распространилось по долине реки Нил, в Европе, Индии и Китае, а в I тысячелетии до нашей эры распространилось на Американский континент. Использование меди, а затем и бронзы знаменовало собой новый, более быстрый прогресс производительных сил, то есть начало новой экономики, основанной на завоевании новых технических приемов.Во всем этом решающую роль играл повседневный человеческий труд, который постоянно влиял на разработку как существующих, так и новых орудий и оружия. С самого начала металлургия основывалась на принципиальном изменении роли сырья, используемого для изготовления орудий и оружия.

Металлические предметы, завершившие свой рабочий цикл или получившие определенные повреждения, не выбрасывались, а использовались как сырье.

Таким образом, постепенно начинает циркулировать сырье, а вместе с ним и процесс производства, использования и его переработки.Это находится в полном противоречии с использованием различных минералов в производстве инструментов из камня или кремня, где всегда существовала острая потребность в восстановлении адекватного сырья. .
Еще одной важной особенностью и преимуществом металла как нового сырья, широко использовавшегося в раннем энеолитическом сообществе, является многообразие его применения. Форма каждого металлического предмета со временем могла быть изменена, в соответствии с его назначением и необходимостью. Например, ювелирные изделия или другие мелкие предметы могут быть переработаны в тяжелые инструменты или оружие и наоборот.

Сохранить

Энеолитические медеплавильные шлаки в Восточных Альпах: локальные закономерности металлургической эксплуатации в медном веке

https://doi.org/10.1016/j.jas.2015.08.013Получить права и содержание медеплавильные шлаки Юго-Восточных Альп были проанализированы на содержание изотопов Pb.

Происхождение руды, основанное на базе данных AAcP, позволяет выявить характер эксплуатации рудника.

Изотопное родство шлаков и одновозрастных объектов указывает на обширное производство меди в Альпах.

Abstract

С помощью изотопного анализа свинца был охарактеризован ряд шлаков всех известных участков итальянских Восточных Альп, свидетельствующих о наличии медеплавильного производства в медном веке. Все исследованные плавильные шлаки из Трентино (Романьяно-Лок, Ла-Вела, Габан, Аквавива-ди-Безенелло, Монтесей-ди-Серсо) и Альто-Адидже/Южный Тироль (Миллан, Гудон, Брессаноне-Чирконваллазионе-Овест) недавно были охарактеризованы тщательными минералогическими, петрографическими и химическими анализами. анализ и продемонстрировал, что он является продуктом плавки меди из минеральной шихты на основе халькопирита с незрелым технологическим процессом извлечения, называемым «энеолитическим» процессом плавки.Пересмотр имеющихся радиоуглеродных дат показывает, что металлургическая деятельность, связанная с проанализированными шлаками, может быть отнесена к третьему тысячелетию до нашей эры. Анализ изотопов свинца ясно показывает, что минеральная шихта, используемая для процесса плавки, была извлечена из близлежащих месторождений полезных ископаемых. Детальный анализ пространственного размещения руд и шлаков позволяет впервые определить локальную организацию металлургического производства.

Ключевые слова

Металлургия меди

Восточные Альпы

Плавильные шлаки

Энеолит

Изотопный анализ свинца

Рекомендованные статьиВсе права защищены.

Рекомендуемые статьи

Ссылки на статьи

Мобильность в эпоху позднего энеолита и ранней бронзы Центральной Европы: геометрия поперечного сечения бедренной кости

Некоторые ученые объясняют отсутствие поселений в богемском и моравском позднем энеолите (археологическая культура шнуровой керамики) следствием скотоводства при высокой степени мобильности. Однако недавние археологические исследования утверждали, что археологические данные позднего энеолита в Центральной Европе демонстрируют свидетельства оседлого образа жизни со смешанным сельским хозяйством, аналогичные последующему раннему бронзовому веку.Поскольку археологические данные не позволяют нам однозначно определить модель подвижности в эти периоды, мы использовали анализ поперечного сечения средней части бедренной кости, чтобы проверить подвижность непосредственно на записи человеческого скелета. Результаты геометрии среднего диафиза бедренной кости не подтверждают высокую степень подвижности в позднем энеолите в Центральной Европе. Этот вывод подтверждается, главным образом, отсутствием существенных различий в мужских группах между поздним энеолитом и ранней бронзой в механической прочности и форме середины бедренной кости, хотя самцы шнуровой керамики по-прежнему демонстрируют самые высокие абсолютные средние значения формы диафиза (I(AP) /I(ML)) и передне-задний второй момент площади.Однако самки позднего энеолита имеют значительно более высокую жесткость на кручение и общую жесткость на изгиб из-за значительно более высокого медиолатерального второго момента площади. Это открытие не может быть напрямую связано с более высокой степенью мобильности этих самок на большие расстояния. Достоверная разница была обнаружена и в общем уменьшении размерных параметров поперечного сечения середины диафиза бедренной кости для одного из образцов раннего бронзового века — самок визельбургера. Поскольку уменьшение размеров и механической прочности самок визельбургера не соответствует параметрам самок эпохи ранней бронзы, можно ожидать мозаичного характера изменений в период позднего энеолита и ранней бронзы, а не простого однонаправленного (диахронического) изменения. механической среды.

Назад в энеолит: изучение орнаментов типа Рудки из Польши

  • Адамчак К. (2013) Сообщества культуры воронкообразных кубков в эпоху возведения монументальных гробниц на территории Польши: ритуалы, сосуды и социальные подразделения. В: Bakker JA, Bloo SBC, Dütting MK (ред.) От надгробных памятников до домашней керамики. Текущие достижения в исследованиях культуры воронкообразных стаканов (TRB / TBK). Материалы встреч Боргера, 2009 г., Нидерланды (= BAR International Series 2474).Archaeopress, Oxford, стр. 177–193

  • Адамчак К., Ковальски Л., Боярский Дж., Вайнкауф М., Гарбач-Клемпка А. (2015a) Клад энеолитических металлических предметов из Калдуса, коммуна Хелмно, Куявско-Поморское воеводство. Spraw Archeol 67: 199–219

    Google Scholar

  • Адамчак К., Ковальски Л., Гарбач-Клемпка А., Добжаньски К. (2015b) Siekieromłot typu Szendrö z Karlowic Małych, woj. opolskie w świetle analiz archeologicznych i metaloznawczych.Śl Spraw Archeol 57:81–92

    Google Scholar

  • Адамчак К., Самборски М., Гарбач-Клемпка А., Беднарз С., Ковальски Л. (2017) Пирвше зналезско энеолитичней сиекеры меддзяней на Мазовшу. Acta Archaeol Lodz 63: 83–92. https://doi.org/10.26485/AAL/2017/63/7

    Google Scholar

  • Энтони Д.У. (2007) Лошадь, колесо и язык: как всадники бронзового века из евразийских степей сформировали современный мир.Издательство Принстонского университета, Принстон

    Google Scholar

  • Баккер Дж., Крук Дж., Лантинг А., Милисаускас С. (1999) Самые ранние свидетельства существования колесных транспортных средств в Европе и на Ближнем Востоке. Древность 73 (282): 778–790. https://doi.org/10.1017/S0003598X00065522

    Артикул Google Scholar

  • Balcer B (1988) Кремневые индустрии эпохи неолита в бассейнах Вислы и Одры. Прз Арчеол 35:49–100

    Google Scholar

  • Bondár M (2012a) Новая модель повозки позднего медного века из Карпатского бассейна. В: Anreiter P, Bánffy E, Bartosiewicz L, Meid W, Metzner-Nebelsic C (eds) Археологическое, культурное и языковое наследие: Festschrift для Erzsébet Jerem в честь ее 70-летия (= Archaeolingua Series Maior 25). Archaeolingua, Будапешт, стр. 79–92

  • Bondár M (2012b) Доисторические модели повозок в Карпатском бассейне (3500–1500 до н.э.) (= Archaeolingua Series Minor 32).Archaeolingua, Будапешт

  • Бондар М., Рацки П. (2009) Кладбище медного века в Будакалаше. Pytheas, Budapest

  • Bronk Ramsey C (2009) Работа с выбросами и смещениями в радиоуглеродном датировании. Радиоуглерод 51 (3): 1023–1045. https://doi.org/10.1017/S0033822200034093

    Артикул Google Scholar

  • Bronk Ramsey C (2017) Методы обобщения наборов радиоуглеродных данных. Радиоуглерод 59 (2): 1809–1833. https://doi.org/10.1017/RDC.2017.108

    Артикул Google Scholar

  • Bronk Ramsey C, Lee S (2013) Недавние и планируемые разработки программы OxCal. Радиоуглерод 55(2–3):720–730. https://doi.org/10.1017/S0033822200057878

    Артикул Google Scholar

  • Bronk Ramsey C, Dee M, Lee S, Nakagawa T, Staff RA (2010) Развитие калибровки и моделирования радиоуглеродных дат.Радиоуглерод 52 (2–3): 953–961. https://doi.org/10.1017/S0033822200046063

    Артикул Google Scholar

  • Bukowska-Gedigowa J (1975) Kultura pucharów lejkowatych w dorzeczu Górnej Odry. Прз Арчеол 23:83–186

    Google Scholar

  • Ciugudean H (2000) Финал энеолита в Трансильвании и Банате: культура Coţofeni (= Bibliotheca Historica et Archaeologica Banatica 26). Эдитура Миртон, Тимишоара

  • Кук С.Р.Б., Ашенбреннер С. (1975) Наличие металлического железа в древней меди. J Полевой археол 2(3):251–266

    Google Scholar

  • De Boer DKG, Borstrok JJM, Leenaers AJG, Van Sprang HA, Brouwer PN (1993) Насколько точен метод фундаментальных параметров? РФА анализ объемных и многослойных образцов. Рентгеновский спектр 22:33–38

    Статья Google Scholar

  • De Muynck D, Cloquet C, Vanhaecke F (2008) Разработка нового метода изотопного анализа Pb археологических артефактов с использованием одноколлекторной ICP-динамической реакционной ячейки-МС.J Anal Atom Spectro 23:62–71

    Статья Google Scholar

  • Элам В.Т., Шен Р.Б., Скраггс Б., Николози Дж. (2004) Точность нестандартного FP-анализа объемных и тонкопленочных образцов с использованием новой атомной базы данных. Adv X-ray Anal 47: 104–109

    Google Scholar

  • Frank C, Pernicka E (2012) Медные артефакты группы Мондзее и их возможные источники. В: Мидгли М.С., Сандерс Дж. (редакторы) Озерные жилища по Роберту Манро, Материалы Международного семинара Манро: озерные жилища в Европе, 22 и 23 октября 2010 г.Эдинбургский университет. Sidestone Press, Лейден, стр. 113–138

    Google Scholar

  • Furholt M (2009) Die nördlichen Badener Keramikstile im Kontext des mitteleuropäischen Spätneolithikums /3650–2900 v.Chr. (= Studien zur Archäologie в Ostmitteleuropa 3). Dr. Rudolf Habelt GmbH, Bonn

  • Galer SJG, Abouchami W (1998) Практическое применение тройной вставки свинца для коррекции различения массы инструмента.Mineral Mag 62:491–492

    Артикул Google Scholar

  • Гарбач-Клемпка А., Козана Дж., Пенькос М., Чеслак В. , Перек-Новак М., Ковальски Л., Адамчак К., Лось Дж. (2015) Медь и мышьяковая медь во время энеолита в металлографических и механических исследованиях. Arch Foundry Eng 15(4):23–28

    Google Scholar

  • Gedl M (2004) Die Fibeln in Polen (= Prähistorische Bronzefunde XIV: 10).Franz Steiner Verlag, Штутгарт

    Google Scholar

  • Goslar T (2018) Описание процедур датирования AMS 14C, используемых в Познанской радиоуглеродной лаборатории. Дата обращения 03.10.18. http://radiocarbon.pl/images/formularze/procedure_ams_prl.doc

  • Horváthová E, Zastawny A (2016) Rádiouhlíkové datovanie ďalších lokalít badenskej kultúry z uzemia Slovenska. Archeol Středni Čechy 20:959–966

    Google Scholar

  • Junghans S, Sangmeister E, Schröder M (1974) Kupfer und Bronze in der frühen Metallzeit Europas. Studien zu den Anfängen der Metallurgie. Манн, Берлин

    Google Scholar

  • Кадар М. (2002) Химический состав доисторических изделий из меди из Трансильвании, Румыния. Архео-металлургический институт. Исследования 22:11–14

    Google Scholar

  • Kasiński W (1936) Skarb miedziany z Przeuszyna w pow. опатовским. Z Otchłani Wieków 11:141

  • Кеттерер М.Е., Петерс М.Дж., Тисдейл П.Дж. (1991) Проверка процедуры коррекции для измерения отношений изотопов свинца с помощью масс-спектрометрии с индуктивно связанной плазмой.J Anal Atom Spectro 6:439–443

    Статья Google Scholar

  • Киенлин Т.Л. (2011) Аспекты развития техники литья и ковки от эпохи меди до эпохи ранней бронзы Центральной и Восточной Европы и Карпатского бассейна. В: Yalc Ü (ed) Анатолийский металл V (= Montanhistorische Zeitschrift. Der Anschnitt 24). Deutsches Bergbau-Museum, Бохум, стр. 127–136

  • Кинлин Т.Л. (2014) Аспекты металлообработки и общества от Черного до Балтийского морей с пятого по второе тысячелетие до нашей эры.В: Робертс Б.В., Торнтон С.П. (ред.) Археометаллургия в глобальной перспективе. Спрингер, Нью-Йорк, стр. 447–472

    Глава Google Scholar

  • Koehler К (1900) Альбом zabytków przedhistorycznych Wielkiego Księstwa Poznańskiego zebranych ш Muzeum Towarzystwa Przyjaciół наук ш Poznaniu 2. Wydawnictwo Przyjaciół наук, Познань

  • Kostrzewski J (1924) Z Badan над osadnictwem wczesnej я środkowej epoki bronzowej на ziemiach польскийПрз Арчеол 2:161–218

    Google Scholar

  • Kostrzewski J (1953) Wytwórczość metalurgiczna w Polsce od neolitu do wczesnego okresu żelaznego. Прз Арчеол 9:177–213

    Google Scholar

  • Kostrzewski J (1962) Скарби и luźne znaleziska metalowe od eneolitu do wczesnego okresu żelaza z górnego i środkowego dorzecza Wisły и górnego dorzecza Warty. Прз Арчеол 15:5–133

    Google Scholar

  • Ковальски Л., Кшишовски А., Адамчак К., Гарбач-Клемпка А. (2016) Wyniki badań archeometalurgicznych tzw.siekiery z Dawnej Miejscowości Антонины, pow. Ходзески. Фонтес Археол Посн 52:175–205

    Google Scholar

  • Ковальски Л., Гарбач-Клемпка А., Добжаньски К. (2017) Вроцлавско-Щитнический топор с фланцем из Коперников Вклад в археометаллургические исследования унетицких топоров в Польше. Археол Рожль 69(4):555–582

    Google Scholar

  • Krause R (2003) Studien zur kupfer -und frühbronzezeitlichen Metallurgie zwischen Karpatenbecken und Ostsee.Verlag Marie Leidorf GmbH, Rahden/Westf

  • Łęczycki S (1982) Kietrz, woj. Ополе, становиско Д. Силезия Antiqua 24:213–217

  • Ленчицки С (2004) Кетш, Бытынь, Щецин-Смердница. Einige Anmerkungen zur Kulturzugehörigkeit des Hortesfundes von Bytyń / Kietrz, Bytyń, Щецин-Смердница. Rozważania на temat przynależności kulturowej skarbu z Bytynia. Spraw Archeol 56:33–77

    Google Scholar

  • Линг Дж., Стос-Гейл З., Грандин Л., Биллстрем К., Хьяртнер-Холдар Э., Перссон П.О. (2014) Движущиеся металлы II: определение происхождения артефактов скандинавского бронзового века с помощью изотопного и элементного анализа свинца.J Archaeol Sci 41:106–132

    Статья Google Scholar

  • Lissauer A (1891) Alterthümer der Bronzezeit in der Provinz Westpreussen und den angrenzenden Gebieten (= Abhandlung zur Landeskunde der Provinz Westpreussen Heft II). Коммиссии Verlag von Th. Bertling, Danzig

  • Lutz J, Pernicka E (1996) Энергодисперсионный рентгенофлуоресцентный анализ древних медных сплавов: эмпирические значения точности и правильности.Археометрия 38(2):313–323

    Статья Google Scholar

  • Мантлер М. , Кавахара Н. (2004) Насколько точны современные методы фундаментальных параметров? Ригаку Дж. 21:17–25

    Google Scholar

  • Матущик I (1996) Brillen- und Hakenspiralen der frühen Metallzeit Europas. Германия 74:1–43

    Google Scholar

  • Matuschik I (2011) Siedlungsarchäologie im Alpenvorland XII: Die Keramikfunde von Hornstaad-Hornle I-VI.Besiedlungsgeschichte der Fundstelle und Keramikentwicklung im beginnenden 4. Jahrtausend v. Chr. im Bodenseeraum (= Forschungen und Berichte zur Vor- und Frühgeschichte в Баден-Вюртемберге, полоса 122). Kommissionsverlag Konrad Theiss Verlag, Stuttgart

  • Mayer EF (1977) Die Äxte und Beile in Österreich (= Prähistorische Bronzefunde IX: 9). К.Х. Beck’sche Verlag, Мюнхен

    Google Scholar

  • Мишка Д. (2011) Последовательность неолитических захоронений во Флинтбеке LA 3, северная Германия, и следы телег: точная хронология. Древность 85 (329): 742–758. https://doi.org/10.1017/S0003598X00068289

    Артикул Google Scholar

  • Мишка Д (2013) Die neolithische Besiedlungsgeschichte im Raum Flintbek und die Bedeutung der Wagenspuren vor dem Hintergrund neuer Datierungen. В: Kadrow S, Włodarczak P (eds) Окружающая среда и средства к существованию — через сорок лет после «Исследований поселений…» Януша Крука (= Studien zur Archäologie in Ostmitteleuropa 11).Dr. Rudolf Habelt GmbH, Бонн, стр. 117–138

  • Модарресси-Техрани Д., Гарнер Дж. (2015) Новые подходы к добыче полезных ископаемых в словацких Рудных горах. В: Argenti Fodina 2014 (= Zborník Prednášok z medzinárodnej konferencie Argenti fodina 2014, ktorá sa konala v dňoch 10.-12. Septembra 2014). Slovenské Banské múzeum, Banska Štiavnica, стр. 45–57

  • Müller J (2012) Aspenstedt-Großer Berg: Ein spätneolithisches Grab mit kupfernem Nietdolch — Hinweis auf eine «verpasste» Innovation. Преист Z 87 (1): 44–57. https://doi.org/10.1515/pz-2012-0003

    Артикул Google Scholar

  • Müller J (2013) Упущенная инновация: самые ранние медные кинжалы в Северной Центральной Европе и Южной Скандинавии. В: Бергербрант С., Сабатини С. (ред.) Очерки археологии и изучения наследия в честь профессора Кристиана Кристиансена. Оксбоу, Оксфорд, стр. 443–448

    Google Scholar

  • Мюллер Дж., Брозио Дж.П., Демник Д., Дибберн Х., Фрич Б., Фурхольт М., Хаге Ф., Хинц М., Лоренц Л., Мишка Д., Ринне К. (2012) Periodisierung der Trichterbecher-Gesellschaften.Эйн Арбайтсентвурф. В: Хинц М., Мюллер Дж. (ред.) Siedlung Grabenwerk Großsteingrab. Studien zu Gesellschaft, Wirtschaft und Umwelt der Trichterbechergruppen im nördlichen Mitteleuropa (= Frühe Monumentalität und soziale Differenzierung 2). Dr. Rudolf Habelt GmbH, Бонн, стр. 29–33

  • Novotná M (1977) Незнайка меденей индустрии словенской. Археол Рожл 29:622–633

    Google Scholar

  • Новак М. (2017) Вездесущие поселенцы, впоследствии фермеры и строители памятников.В: Урбанчик П., Влодарчак П. (ред.) Общества прошлого: польские земли от первых свидетельств присутствия человека до раннего средневековья. Том. 2: 5500–2000 гг. до н.э. IAiE PAN, Варшава, стр. 125–170

    Google Scholar

  • О’Брайен В. (2015) Доисторическая добыча меди в Европе. 5500–500 до н.э. Издательство Оксфордского университета, Оксфорд

    Google Scholar

  • Pieczyński Z (1985) Uwagi o skarbie miedzianym z Bytynia, woj.познанские. Fontes Archaeol Posn 34:1–7

    Google Scholar

  • Pieczyński Z (1986) Skarb miedziany ze Skarbienic, woj. быдгоские. Фонтес Археол Посн 35:35–40

    Google Scholar

  • Popa CI (2013) Мотив-символ pe vasele ceramice Coţofeni: cercuri concentrice, Spirale, Spirale-ochelari, Terra Sebus. Acta Mus Sabes 5: 77–110

    Google Scholar

  • Przybył A (2009) Społeczności późnoneolitycznej kultury pucharów lejkowatych na Kujawach.Проблема wpływów z kręgu kultury badeńskiej. Wydawnictwo Poznańskie, Poznań

  • Przybył A (2015) Баденский комплекс и культура воронкообразных кубков в польской низменности. Проблема «низменной баденизации». В: Новак М., Заставны А. (ред.) Баденская культура вокруг Западных Карпат (= Via Archaeologica. Źródła z badań wykopaliskowych na trasie autostrady A4 w Małopolsce). Krakowski Zespół do Badań Autostrad, Краков, стр. 471–494

    Google Scholar

  • Пшибыл А (2017) С юга на север.Люди культуры Бадена и их соседи. В: Урбанчик П., Влодарчак П. (ред.) Общества прошлого: польские земли от первых свидетельств присутствия человека до раннего средневековья. Том. 2: 5500–2000 гг. до н.э. IAiE PAN, Варшава, стр. 171–209

    Google Scholar

  • Rademakers FW, Nikis N, De Putter T, Degryse P (2018a) Производство и торговля медью в бассейне Ниари (Республика Конго) в период с 13 по 19 век н. э.: химические вещества и изотопы свинца характеристика.Археометрия. https://doi.org/10.1111/arcm.12377

  • Радемакерс Ф.В., Верли Г., Дельво Л., Дегриз П. (2018b) Медь для загробной жизни в Египте от додинастического до Древнего царства: характеристика происхождения с помощью химического анализа и анализа изотопов свинца (коллекция RMAH, Бельгия). J Archaeol Sci 96:175–190

    Статья Google Scholar

  • Реймер П.Дж., Бард Э., Бейлисс А., Бек Дж.В., Блэквелл П.Г., Бронк Рэмси С., Гроотс П.М., Гуилдерсон Т.П., Хафлидасон Х., Хайдас И., Хаттэ С., Хитон Т.Дж., Хоффманн Д.Л., Хогг А.Г., Хьюэн К.А., Kaiser KF, Kromer B, Manning SW, Niu M, Reimer RW, Richards DA, Scott EM, Southon JR, Staff RA, Turney CSM, van der Plicht J (2013) IntCal13 и Marine13 калибровочные кривые радиоуглеродного возраста 0–50 000 лет кал. .Радиоуглерод 55 (4): 1869–1887. https://doi.org/10.2458/azu_js_rc.55.16947

    Артикул Google Scholar

  • Роман П. И. (1976) Cultura Coţofeni (= Biblioteca de Arheologie 26). Editura Academiei Republicii Socialiste România, Bucharest

    Google Scholar

  • Schreiner M (2007) Erzlagerstätten im Hrontal, Slowakei: Genese und prähistorische Nutzung (= Forschungen zur Archäometrie und Altertumswissenschaft, Band 3).Verlag Marie Leidorf Gmbh., Rahden/Westf

  • Schreiner M, Heyd V, Pernicka E (2012) Kupferzeitliches Metall in der Westslowakei. В: Kujovský R, Mitáš V (eds) Václav Furmánkek and doba bronzová. Zborník k sedemdesiatym narodeninám (= Archaeologica Slovaca Monographiae — Communicationes 13). Archeologicy ústav Slovenskej akadémie vied, Nitra, стр. 355–366

  • Schwartz FLW (1881) Materialien zu einer prähistorischen Karte der Provinz Posen. Нахтраг III. Beilage zum Programm des Königlichen Гимназия Фридриха Вильгельма в Позене.Hofbushdruckerei von W. Decker & Comp., Posen

  • Скотт Д.А. (1991) Металлография и микроструктура древних и исторических металлов. Институт сохранения Гетти, Музей Дж. Пола Гетти, Лос-Анджелес

    Google Scholar

  • Скотт М.Е., Кук Г.Т., Нейсмит П. (2007) Ошибка и неопределенность в радиоуглеродных датах. Радиоуглерод 49(2):427–440. https://doi.org/10.1017/S0033822200042351

    Артикул Google Scholar

  • Seger H (1907) Depotfunde aus der Bronze- und Hallstattzeit.В: Маснер К., Сегер Х. (ред.) Schlesiens Vorzeit in Bild und Schrift. Zeitschrift des Schlesischen Altertumsvereins. Новый Фольге. Jahrbuch des schlesischen Museums für Kunstgewerbe und Altertümer. Группа 4. Друк фон Грасс, Barth & Comp. (В. Фридрих), Бреслау, стр. 9–43

  • Шерратт А. (1981) Плуг и скотоводство: аспекты революции вторичных продуктов. В: Ходдер I, Исаак Г., Хаммонд Н. (ред.) Модель прошлого: исследования в честь Дэвида Кларка. Издательство Кембриджского университета, Кембридж, стр. 261–305

    Google Scholar

  • Шеррат А. (1983) Вторичная эксплуатация животных в Старом Свете.World Archaeol 15:90–104

    Статья Google Scholar

  • Шеррат А. (1986) Шерсть, колеса и следы плуга: местные разработки или внешние интродукции в неолитической Европе? Bull Inst Archaeol 23: 1–15

    Google Scholar

  • Шеррат А. (2006) Животное тяговое усилие и трансформация неолитической Европы. В: Петрекен П., Арбогаст Р. М., Петрекен А. М., ван Виллиген С., Байи М. (ред.) Колесницы премьер, премьеры araires.Распространение тягловых животных в Европе подвеска les IVe et IIIe millénaires avant notre ère (= CRA Monograph 29). CNRS, Париж, стр. 329–360

    Google Scholar

  • Ситко Р. (2007) Влияние спектрального распределения рентгеновской трубки на неопределенность расчетной интенсивности флуоресцентного излучения. Spectrochim Acta B 62:777–786

    Артикул Google Scholar

  • Ситко Р. (2008) Исследование влияния спектрального распределения рентгеновской трубки на анализ объемных образцов и тонких пленок: метод фундаментальных параметров и алгоритмы теоретических коэффициентов.Spectrochim Acta B 63:1297–1302

    Артикул Google Scholar

  • Ситко Р., Завиша Б. (2012) Количественная оценка в рентгенофлуоресцентной спектрометрии. В: Шарма С.К. (ред.) Рентгеновская спектроскопия. IntechOpen, Риека, стр. 137–162. https://doi.org/10.5772/29367

    Google Scholar

  • Сохацкий З. (1981) Баденская культура. Археол Пол 20: 27–63

    Google Scholar

  • Стос З.А. (2009) Через винные темные моря… матросы-лудильщики и королевские грузы в восточном Средиземноморье эпохи поздней бронзы. В: Шортленд А.Дж., Фристоун И.К., Ререн Т. (ред.) От рудника к микроскопу — достижения в изучении древних технологий. Oxbow Books, Оксфорд, стр. 163–180

    Google Scholar

  • Стос-Гейл З.А., Гейл Н.Х. (2009) Происхождение металлов с использованием изотопов и Оксфордской археологической базы данных изотопов свинца (OXALID). Archaeol Anthropol Sci 1(3):195–213

    Статья Google Scholar

  • Струхар В., Сояк М., Чебен И. (2015) Поселения баденской культуры на вершинах холмов в Северной Словакии и их «социально-символическое» значение.В: Новак М., Заставны А. (ред.) Баденская культура вокруг Западных Карпат (= Via Archaeologica. Źródła z badań wykopaliskowych na trasie autostrady A4 w Małopolsce). Krakowski Zespół do Badań Autostrad, Краков, стр. 275–310

    Google Scholar

  • Сухи Дж. С., Гарбач-Клемпка А., Адамчак К. , Ковальски Л., Козана Дж., Перек-Новак М., Шуцкий М., Пенькос М. (2016) Металлографические исследования избранных артефактов энеолита и бронзового века из Польши.Key Eng Mater 682: 151–159. https://doi.org/10.4028/www.scientific.net/KEM.682.151

    Артикул Google Scholar

  • Сулимирски Т. (1960) Замечания относительно распространения некоторых разновидностей кремня в Польше. Святовид 23: 281–307

    Google Scholar

  • Szpunar A (1987) Die Beile in Polen I (Flachbeile, Randleistebeile, Randleistemeißel) (= Prähistorische Bronzefunde IX: 16).К.Х. Beck’sche Verlagsbuchhandlung, Мюнхен

    Google Scholar

  • Техасский университет в Остине (2017 г.) Quadrupole ICP-MS Lab. Ограничения 8. Дата обращения 02.10.17. http://www.jsg.utexas.edu/icp-ms/icp-ms/

  • Точик А. , Жебрак П. (1989) Ausgrabungen в Испании Долина-Пиески. Zum Проблема де urzeitlichen Kupfererzbergbaues в дер Slowakei. В: Hauptmann A, Pernicka E, Wagner GA (eds) Archäometallurgie der Alten Welt: Beiträge zum Internationalen Symposium «Археометаллургия Старого Света», Heidelberg 1987, Deutsches Bergbau-Museum, Бохум, стр. 71–78

  • Truhelka 5 (189 Ć ) Prähistorische Bronzen aus dem Bezirke Prozor.В: Hoernes M (ed) Wissenschaftliche Mitteilungen aus Bosnien und der Hercegowina 3. Bosnisch-Herzepowinischen Landesmuseum в Сараево, Вена, стр. 510–512

    Google Scholar

  • Уолдер А.Дж., Платцнер И., Фридман П.А. (1993) Измерение соотношения изотопов в смесях свинца, неодима и неодима-самарий, гафния и смесей гафния-лютеция с помощью масс-спектрометра с индуктивно-связанной плазмой с двойной фокусировкой и несколькими коллекторами. J Anal Atom Spectro 8:19–23

    Статья Google Scholar

  • Wierzbicki J (2013) Wielka kolonizacja. Społeczności kultury pucharów lejkowatych w dorzeczu środkowej Warty. SNAP, Poznań

  • Wilk S (2016) Новые данные о хронологии воздействия горизонта Hunyadihalom-Lažňany на более молодые дунайские культуры к северу от Карпат. Rech Archéol Nouvelle Ser 7: 7–28

    Google Scholar

  • Zastawny A (2015a) Баденский комплекс в Малопольше – горизонты культурных влияний. В: Новак М., Заставни А. (ред.) Баденская культура вокруг Западных Карпат (= Via Archaeologica.Źródła z badań wykopaliskowych на трассе автострады A4 в Малопольше). Krakowski Zespół do Badań Autostrad, Краков, стр. 119–150

    Google Scholar

  • Zastawny A (2015b) Абсолютная хронология баденской культуры в Малопольше – новые радиоуглеродные даты. В: Новак М., Заставны А. (ред.) Баденская культура вокруг Западных Карпат (= Via Archaeologica. Źródła z badań wykopaliskowych na trasie autostrady A4 w Małopolsce). Krakowski Zespół do Badań Autostrad, Краков, стр. 191–219

    Google Scholar

  • Zastawny A, Horváthová E (2017) Kultura badenska pomiędzy dorzeczem górnej Wisły a północnym Pocisiem.Польско-словацкий проект Бадан транскарпачской культурной релаксации. В: Gancarski J (ed) Stan i potrzeby badań archeologicznych w Karpatach. Muzeum Podkarpackie, Ruthenus, Krosno, стр. 245–268

  • Žebrák P (1995) Следы первичной добычи цветных металлов в Словакии. В: Петрович П., Джурджеканович С. (ред.) Древнее горное дело и металлургия в Юго-Восточной Европе: международный симпозиум, Дони Милановац, 20–25 мая 1990 г. Музей горного дела и металлургии, Бор, стр. 13–19

    . Google Scholar

  • Неоэнеолитическая схема поселений и добыча соли в Румынской Молдавии

    Румынская Молдавия находится в центре внимания исследования, начатого в 2005 г., посвященного динамике поселений эпохи неолита-энеолита (6000–3500 г. до н. э.) и добыче соли.Основная гипотеза состоит в том, что эксплуатация соли, наряду с добычей меди и золота, способствовала возникновению развитых энеолитических обществ с начала 5-го тысячелетия до нашей эры. Подойдя к этому процессу через его географическое измерение, с начала VI тысячелетия до н.э., можно измерить одновременность тех или иных фактов, будь то социальных (утверждение элит), территориальных (появление контролирующих мест) или технических (первые медная металлургия, интенсификация добычи соли).

    Подкарпатский регион восточной Румынии представляет особый интерес, так как плотность соляных источников намного выше, чем где-либо еще, добыча соли относится к раннему неолиту (Криш), и регион впоследствии превращается в энеолитический культурный центр (Прекукутень и Кукутень). ) несравненного богатства и важности.

    После десятилетия исследований природы и использования солевых ресурсов, а также создания археологической базы данных, охватывающей период с 6 000 до 3 500 до н. э., мы теперь можем провести предварительную оценку территориальных стратегий, реализованных этими обществами в Восточном Прикарпатье.Археологические подходы дополняются использованием мощных инструментов, таких как ГИС, и применением методов пространственного анализа, что позволяет нам моделировать модели и динамику поселений.

    В результате этих анализов появилось несколько результатов. Для раннего неолита наблюдается целостная модель расселения: стоянки, часто сгруппированные и в настоящее время взаимовидимые, расположены в долинных зонах и на скромных террасах вблизи второстепенных водотоков. С появлением культуры Linearbandkeramik (LBK) эта ситуация меняется: теперь поселения гораздо более рассредоточены, поселения основаны на более открытом ландшафте.

    В первой половине 5-го тысячелетия мы наблюдаем радикальное изменение предпочитаемого топографического контекста: предпочтение отдается высокогорным и среднегорным террасам, тенденция, которая отражается в основании поселений на открытых мысах, откуда открывается особенно захватывающий вид на более широкая область. Вслед за заметной диверсификацией форм землепользования во второй половине V тыс. до н.э. начало IV тыс. характеризуется уплотнением населенных пунктов и усилением территориального контроля.

    Анализ доступности соляных источников позволяет продолжить эти наблюдения. Во-первых, мы отмечаем значительное увеличение стоянок, расположенных вблизи соляных источников, в период, охватывающий вторую половину V тысячелетия и первую половину IV тысячелетия. Именно в течение этих двух фаз увеличивается использование соли. Во-вторых, количество важных укреплений и престижных товаров (медные топоры), расположенных рядом с соляными источниками, иллюстрирует поляризующую роль соляных ресурсов.

    Анализ митохондриальной ДНК энеолитических трипольцев из Украины выявил генетические корни неолитического земледелия

    Abstract

    Аграрная революция в Восточной Европе началась в эпоху энеолита с культурного комплекса Кукутень-Триполье. В Украине трипольская культура (ТК) существовала более двух тысячелетий (ок. 5 400–2 700 до н.э.) и оставила множество артефактов. Однако ритуалы их погребения остаются загадкой, и на сегодняшний день почти ничего не известно о генетическом составе популяции ТК.Одно из очень немногих мест ТЦ, где можно найти человеческие останки, — пещера Вертеба на западе Украины. В этом отчете представлены четыре частичных и четыре полных митохондриальных генома девяти особей TC, обнаруженных в пещере. Результаты этого анализа в сочетании с данными из предыдущих отчетов показывают, что трипольское население в Вертебе носило, по большей части, типичный неолитический фермерский пакет линий митохондриальной ДНК (мтДНК), восходящий к анатолийским фермерам и неолитическим фермерским группам центральных районов. Европа.В то же время находка двух экземпляров гаплогруппы U8b1 в Вертебе может рассматриваться как связь ТК с верхнепалеолитическими европейскими популяциями. На уровне частот гаплогрупп мтДНК популяция TC из Вертебы демонстрирует тесную генетическую связь с группами населения культурного комплекса Funnel Beaker/ Trichterbecker из Центральной и Северной Европы (ок. 3950–2500 гг. до н. э.).

    Образец цитирования: Никитин А.Г., Потехина И., Роланд Н., Маллик С., Рейх Д., Лилли М. (2017) Анализ митохондриальной ДНК энеолитических трипольцев из Украины выявляет генетические корни неолитического земледелия.ПЛОС ОДИН 12(2): e0172952. https://doi.org/10.1371/journal.pone.0172952

    Редактор: Кристиан Капелли, Оксфордский университет, СОЕДИНЕННОЕ КОРОЛЕВСТВО

    Поступила в редакцию: 1 сентября 2016 г.; Принято: 13 февраля 2017 г .; Опубликовано: 24 февраля 2017 г.

    Copyright: © 2017 Nikitin et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации. Файлы генетических последовательностей, указанные в рукописи, доступны через GenBank (https://www.ncbi.nlm.nih.gov/genbank/) под номерами доступа KY198376-198382.

    Финансирование: Раскопки в Вертебе в сентябре 2007 года были частично профинансированы за счет гранта Мичиганского космического консорциума для исследований AGN. Раскопки в мае-июне 2008 г. проводились в рамках программы ГВСУ «Обучение за границей в Украине» в 2008 г.Анализ ДНК в GVSU финансировался за счет исследовательского гранта и фондов развития преподавателей GVSU. DR — исследователь Медицинского института Говарда Хьюза. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Культурный комплекс Кукутень-Триполье доминировал в культурном ландшафте предгорий Карпат в восточной Румынии, Молдове и на территории современной Украины к западу от Днепра в период энеолита (медного века) в Восточной Европе, ок. 5400–2700 гг. До н.э. В своих западных ареалах она известна как культура Кукутень, а в восточной ее части известна как трипольская культура (ТК) по названию села Триполье на территории нынешней центральной Украины, где она была впервые идентифицирована Викентием Хвойкой в ​​конце XIX в. век [1].

    На протяжении более 2000 лет TC влиял на ход человеческой популяции и историю культуры в Восточной Европе. Одними из самых известных достижений TC являются его протогородские мегаполисы, датируемые 4 100–3 600 годами до нашей эры.Это архитектурные феномены коммунальной жизни, каждый участок площадью более 150 га с тщательно спланированной планировкой и сотнями зданий, способных вместить более 10 000 человек [2]. Тот факт, что трипольские группы вели активную торговлю и взаимодействие со своими соседями, хорошо задокументирован в археологических данных [3]. Трипольскими соседями на севере и северо-западе были группы культур Lengyel и Funnel Beaker (FBC, также Trichterbecker или TRB). На юге ТЦ взаимодействовал со степными популяциями Северного Причерноморья (СПР), с которыми ТЦ образовал степно-аграрный конгломерат, названный Усатово ок.3300 г. до н.э., что произвело неизгладимое впечатление на регион и за его пределы. Помимо впечатляющих курганов (курганов), оставленных усатовцами, Усатово, вероятно, также способствовало распространению индоевропейских языков по всей Европе, в частности, помогая наладить связь между степными и TRB-группами с юго-востока Польши, тем самым способствуя установлению Догерманские диалекты [4].

    Материальная культура ТК, в том числе искусно расписанная керамика, обширный массив антропоморфных и зооморфных глиняных фигурок, а также разнообразные орудия для обработки земли и обработки зерна, убедительно свидетельствует об аграрной основе экономики ТК [3,5]. ].Хотя происхождение средств к существованию и культурных атрибутов Триполья восходит к европейским фермерам эпохи неолита, степень биологического родства жителей ТК с неолитическими европейскими земледельческими группами остается неясной.

    Основным препятствием в изучении генетического происхождения носителей ТК является то, что, оставляя после себя большие объемы материальных культурных свидетельств, остается очень мало следов самих обитателей ТК. На самом деле человеческие захоронения практически неизвестны до последней части хронологии ТХ [6].Единственная обнаруженная на сегодняшний день стоянка ТЦ, которая содержит непрерывную запись остеологических отложений человека, — это гипсовая пещера под названием Вертеба, расположенная в Подольском районе на западе Украины.

    Пещера Вертеба (широта: 48,47/долгота: 25,53) расположена в юго-западной бореальной лесостепной зоне Восточно-Европейской равнины. Вертеба содержит самые ранние человеческие останки, принадлежащие ТК [7]. Реконструированная хронология участка предполагает несколько фаз захоронения человеческих останков, охватывающих значительный период трипольского культурного существования, ок.3950–2700 гг. до н. э. [7]. В пещере также были обнаружены человеческие останки, датированные поздним бронзовым веком (ок. 1015–420 гг. до н. э.) [8]. Таким образом, Вертеба представляет собой уникальную запись ритуальной деятельности человека, охватывающую более 1000 лет для TC и продолжающуюся еще как минимум 1500 лет. Наличие человеческих останков дает возможность изучить динамику населения в этом районе с помощью генетического и антропологического анализа, особенно в отношении понимания биологического происхождения TC.

    Более раннее археогенетическое исследование, проведенное на древней митохондриальной ДНК (мтДНК), выявило линии, характерные для европейских неолитических земледельцев, в останках ТК из Вертебы [7].До бронзового века в Вертебе не было найдено никаких линий, которые можно было бы идентифицировать как принадлежащие к автохтонным группам охотников-собирателей [8]. Антропологические исследования останков ТС согласуются с данными мтДНК и характеризуют популяцию ТС как принадлежащую преимущественно к изящному средиземноморскому типу, распространенному в неолитических земледельческих сообществах Европы и Анатолии. В то же время среди остатков ТК был выявлен и более устойчивый краниологический тип, характерный для европейских популяций позднего плейстоцена, а также для степных популяций СНП [9–11].Эти находки позволили сделать общий вывод о родстве ТК с потомками анатолийских земледельцев, а сама культура стала рассматриваться как расширение европейских неолитических земледельческих сообществ на восток [3]. Наличие робастного краниологического типа считалось свидетельством примеси с местными мезолитическими популяциями, а также с популяциями из степей Северного Причерноморья [9–11], но природа и масштабы этой примеси оставались неясными. Небольшой размер выборки и охват исследования ранней древней ДНК (аДНК) с низким разрешением [7] не позволили провести сравнительную количественную оценку трипольских линий мтДНК с другими доисторическими группами.В этом отчете представлены семь новых образцов из Вертебы, а два ранее зарегистрированных образца подвергаются повторной оценке, чтобы расширить наши знания о материнских генетических детерминантах TC, что позволяет поместить наследие TC мтДНК в общеконтинентальный контекст частот гаплогрупп мтДНК. доисторическое население Евразии.

    Материалы и методы

    Происхождение образцов

    Образцы, представленные в этом исследовании, были обнаружены во время раскопок в пещере Вертеба, проведенных под руководством Борщевского историко-краеведческого музея в Борщеве, Украина (Михаил Сохацкий, директор музея и раскопок) в полевой сезон 2007–2008 гг. (разрешение на раскопки №268/0317, выданный Институтом археологии НАН Украины).Подробное описание раскопок на этом месте см. в [7]. Находки, полученные при раскопках, в том числе остеологический материал человека, помещены в постоянное хранилище Борщевского историко-краеведческого музея в Борщеве, Украина, и находятся в открытом доступе. Образцы ДНК (фрагменты зубов и черепа) были взяты из образцов V1.1.1, V1.2, V3.13.1, V3.14.1, V3.15.1, V3.16.1 и V3.17.1. Кроме того, два ранее зарегистрированных образца, A22 и M5 [7], были повторно типированы в текущем исследовании.A22 постоянно не давал данных по аДНК в предыдущих попытках, а образец M5 был лучшим образцом для аДНК в предыдущих анализах. На основании радиоуглеродных дат человеческих останков и связанных с ними черепков керамики образец A22 датируется 4000–3400 годами до нашей эры [7]. Образец М5 был датирован 3600–2900 гг. до н. э. [7]. Хронологический возраст остальных образцов, использованных в настоящем исследовании, был помещен в диапазон 3700–3500 лет до н.э. на основании радиоуглеродного датирования образца V1.2 [12]). Участок № 7, где собраны экземпляры V1.1.1-V3.17.1 был обнаружен с использованием глиняных черепков, а также останков людей и животных в диапазоне 3700–2700 г. до н.э., с пиковой активностью на этом участке около 3500 г. до н.э. [7].

    Извлечение и анализ древней ДНК – Государственный университет Гранд-Вэлли (GVSU)

    Экстракцию древней ДНК (аДНК) и анализ ПЦР-SNP с низким разрешением диагностических кодирующих и гипервариабельных 1 (HVR-1) областей мтДНК с последующим секвенированием ДНК по Сэнгеру проводили, как описано в [13].Экстракцию ДНК из образцов V1.1.1, V1.2, V3.14.1, V3. 15.1, V3.16.1 и V3.17.1 проводили из отдельных зубов за однократное выделение из каждого зуба. Анализ ДНК образца В3.13.1 в ГВСУ не проводился. Для M5 и A22 было выполнено три независимых временных разделения ДНК на зубах, материале нижнечелюстной кости (M5) и различных пястных костях и фалангах (A22).

    Для обеспечения достоверности результатов строго соблюдались передовые процедуры работы с аДНК (обобщенные в [14]).Все манипуляции с аДНК проводились в специальном помещении для аДНК с ограниченным доступом с двумя боксами с ламинарным потоком, оснащенными фильтрацией воздуха HEPA и внутренними системами УФ-излучения (один бокс для выделения ДНК, один для настройки ПЦР). Полный комбинезон, лицевые маски и лицевые щитки носили все время во время всех манипуляций с образцами. Чтобы еще больше снизить вероятность заражения современной ДНК при обработке, все манипуляции с образцами до ПЦР выполнялись одним человеком.

    Образцы костей были очищены в отдельном помещении под химическим вытяжным шкафом путем ошкуривания ~ 1 мм поверхности для удаления поверхностных загрязнений. Образцы облучали со всех сторон УФ-светом с длиной волны 253,5 нм. Около 1 г кости удаляли за одну экстракцию с помощью инструмента Dremel и измельчали ​​в порошок с использованием стерилизованной фарфоровой ступки и пестика. Порошок трижды промывали ЭДТА, рН 8,0, а затем три раза промывали стерильной водой, рН 7. ДНК экстрагировали с использованием набора QIAGEN QIAmp DNA Investigator Kit (QIAGEN Inc., Валенсия, Калифорния, США) в соответствии с модифицированным протоколом QIAamp для экстракции ДНК. ДНК из кости. Для каждой экстракции использовали отрицательный контроль.Экстрагированную ДНК элюировали 20-25 мкл стерильной воды и хранили при -20°С.

    HVR-1 и диагностические кодирующие области были амплифицированы с использованием ранее описанных праймеров [13]. Четыре пары праймеров использовали для амплификации области HVR-1 в перекрывающихся сегментах длиной 145–164 п.н., как описано в [13]. Дополнительную пару праймеров (L16185: AACCCAATCACATCAAAACC; h26273: AGGGTGGGTAGGTTTGTTGGTATCC), дающую фрагмент длиной 133 п. н., использовали для улучшения разрешения в положении нуклеотида 16189 HVR-1.Сайты диагностических кодирующих участков мтДНК для гаплогрупп H (нуклеотидное положение 7028), J/T (нуклеотидное положение 4216) и U (нуклеотидное положение 12308) амплифицировали с использованием ранее опубликованных праймеров [15]. Отрицательные контроли использовались для обнаружения загрязнения, а положительные контроли, созданные отдельно от аДНК, использовались для установления эффективной химии ПЦР. Амплификацию проводили с использованием набора QIAGEN Fast-Cycling PCR Kit, как указано в протоколе набора, в условиях, оптимизированных для фрагментов в диапазоне 10–100 копий.Циклы усиления сохранялись на уровне 49 раундов. Каждый сегмент кодирующей и контрольной области амплифицировали до четырех раз за одну экстракцию или до получения двух независимых продуктов амплификации. Успешные амплификации очищали с помощью набора Qiagen MinElute и элюировали 10 мкл стерильной воды.

    Успешные амплификации клонировали лигированием в векторы QIAGEN pDrive с использованием набора QIAGEN PCR Cloning Kit. Трансформированные клетки выращивали на стерильных чашках с агаром LB-Amp и инкубировали при 37°С в течение 16-20 часов.Клетки, содержащие ПЦР-вставку, отбирали с помощью сине-белой дифференцировки, повторно высевали и снова инкубировали при 37°С в течение 20–26 часов. Субкультивированные клетки элюировали стерильной петлей в 250 мкл стерильной воды. Амплификацию клонированной ДНК проводили с использованием 1 мкл ресуспендированных клеток с универсальными праймерами SP6 и T7 для амплификации всего фрагмента в сайте клонирования плазмиды. После первых 5 минут при 95°С для лизиса клеток было проведено 29 циклов ПЦР: 94°С в течение 30 секунд, 42°С в течение 45 секунд, 72°С в течение 90 секунд с одной стадией элонгации при 72°С в течение 5 секунд. минут в конце 29 циклов.Для подтверждения вставки нужного ПЦР-фрагмента в плазмидный вектор продукты ПЦР визуализировали на 2,5% агарозном геле.

    Анализ секвенирования ДНК по Сэнгеру был выполнен в Научно-исследовательском институте воды Аннис при ГВГУ. Реакции секвенирования проводили на 96-луночных планшетах с использованием набора BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) в течение 45 раундов. Реакции секвенирования очищали перед секвенированием с использованием стандартного протокола Sephadex. Образцы анализировали на генетическом анализаторе ABI 3130×1 с 50-сантиметровой капиллярной решеткой.

    Анализ последовательности ДНК

    выполняли с использованием инструментов NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) путем сопоставления с пересмотренной Кембриджской эталонной последовательностью (rCRS) мтДНК [16] (GenBank accession № NC 012920) для определения дифференцировки SNP. Варианты SNP были сопоставлены с филогенетическим деревом глобальных вариаций мтДНК человека (phylotree.org), основанным на полиморфизме как кодирующей, так и контрольной области, для определения назначения гаплогруппы. Все хроматограммы были тщательно проанализированы с помощью программы просмотра последовательностей ДНК 4Peaks (A. Griekspoor and Tom Groothuis, mekentosj.com), а неоднозначные базовые назначения вызывались вручную.

    Чтобы гарантировать достоверность результатов аДНК, использовали несколько критериев, включая количественную оценку длины фрагмента ДНК на основе данных биоанализатора (ожидается, что аДНК будет сильно фрагментирована), оценку частоты успешной амплификации в зависимости от размера фрагмента (более короткие фрагменты следует предпочтительно амплифицировать в смесь аДНК/загрязнения), множественные ПЦР-амплификации одной и той же области для каждого образца, короткая длина амплифицированных фрагментов (128–266 п.н.), амплификация перекрывающихся фрагментов, совпадение SNP в перекрывающихся фрагментах и ​​клонирование амплифицированных фрагментов ДНК.Исследовали молекулярное поведение амплифицированных фрагментов. Последовательности, считающиеся подлинной аДНК, демонстрировали признаки повреждения дезаминирования, а также потенциал повышенной химеризации. Кроме того, ожидалось, что паттерны SNP из подлинной аДНК будут иметь филогенетический смысл. Дополнительный надежный критерий подлинности был достигнут путем дублирования анализов мтДНК образцов в Гарвардской медицинской школе (HMS).

    Анализ ДНК – Гарвардская медицинская школа (HMS)

    Извлечение ДНК из образцов, перечисленных в таблице S1 для производства данных секвенирования следующего поколения, было проведено в лаборатории древней ДНК в HMS в соответствии с протоколом, описанным в [17] с изменениями в [18].После приготовления UDG-обработанных библиотек Illumina со штрих-кодом [19] из экстрактов ДНК один образец (I2109) не прошел амплификацию библиотеки (таблица S1). Библиотеки, показавшие успешную амплификацию библиотек, были подвергнуты обогащению цельной митохондриальной ДНК, как описано ранее [19], и парному секвенированию концов в течение 2×76 циклов и двойному индексированию было выполнено на Illumina NextSeq500. Кроме того, мы выполнили дробовое секвенирование всех библиотек. Биоинформатический анализ проводили, как описано в [20].Анализ ДНК образцов V3. 15.1 и V3.16.1 в ГМС не проводился.

    Статистический анализ

    Анализ основных компонентов (PCA) был проведен на частотах гаплогрупп мтДНК 37 доисторических евразийских популяций, перечисленных в таблице S2, в соответствии с подразделениями гаплогрупп мтДНК, определенными для каждой популяции в соответствующем источнике публикации. Анализ PCA был выполнен с использованием программного обеспечения IBM SPSS Statistics, версия 20. Численность населения и источники данных перечислены в таблице S2.Для трипольской популяции из Вертебы (TC) данные гаплогруппы мтДНК для образцов из этого отчета были объединены с данными для образцов, описанных в [7], заменив идентификацию гаплогруппы для образца M5, приведенного в [7], на более полную информацию о гаплотипировании из этого отчета. Представление гаплотипов из [7] следующее: гаплогруппа Н – две особи (включая М5), HV0 – одна особь, HV/V – две особи, J – одна особь, Т2 – одна особь.

    Результаты

    В GVSU все восемь образцов Verteba, подвергшихся анализу мтДНК, дали данные о древней последовательности мтДНК (таблица 1). Образец V1.2 не амплифицируется на HMS из-за ингибирования (таблица S1). Образец A22 изначально был отнесен к гаплогруппе H5b и дал 17-кратное покрытие мтДНК в HMS, но его оценка загрязнения мтДНК с использованием программного обеспечения contamMix [21] предполагает только 90% последовательностей, соответствующих консенсусу, что является существенным уровнем загрязнения. Образец V1.1.1 дал 2-кратное покрытие в HMS без определения гаплогруппы. В GVSU образцы V3.17.1, V1.2 и A22 не давали отклонений нуклеотидов от rCRS в HVR-1 и исследованных сегментах кодирующей области.Таким образом, эти три образца были обозначены как принадлежащие к гаплогруппе H. Все три показали снижение эффективности амплификации. В то же время все три демонстрировали образцы дезаминирования, соответствующие посмертным повреждениям. Однако, основываясь на результатах амплификации A22 в HMS, а также учитывая, что A22 не удалось амплифицировать в предыдущих попытках GVSU, результаты гаплотипирования для A22 могут не представлять эндогенную аДНК. Поэтому образец А22 был исключен из дальнейшего анализа.

    Таблица 1.Однонуклеотидные полиморфизмы (SNP) и соответствующие гаплогруппы митохондриальной ДНК для образцов Verteba из частичных последовательностей мтДНК, полученных в Государственном университете Гранд-Вэлли (GVSU) для кодирования (диапазоны последовательностей: 4153–4396, 6950–7051, 12217–12308) и HVR-I (диапазон последовательностей: 15974–16407) и полные последовательности митохондриального генома, полученные в Гарвардской медицинской школе (HMS, диапазон последовательностей: 1–16569).

    Сообщаемые положения нуклеотидов являются изменениями по сравнению с пересмотренной Кембриджской эталонной последовательностью (rCRS) [16].

    https://doi.org/10.1371/journal.pone.0172952.t001

    Анализ HMS выявил диагностический полиморфизм в V3.17.1 для гаплогруппы H5a. Образец M5, ранее идентифицированный как принадлежащий к гаплогруппе H ([7], номер доступа в GenBank JN098425), продуцировал полиморфизмы как в лабораториях GVSU, так и в лабораториях HMS, которые характерны для гаплогруппы h2b. Образец V3.13.1 был отнесен к гаплогруппе HV в HMS. Образец V3.14.1 был отнесен к гаплогруппе T2b обеими лабораториями. Образец V3.16.1 нес кодирующую область и полиморфизмы HVS-1, диагностические для гаплогруппы HV0.Остальные два экземпляра, V1.1.1 и V3.15.1, были идентифицированы как представители клады U в GVSU. Образец V1.1.1 не дал достаточной амплификации при HMS (таблица S1). Образец V3.15.1 относился к гаплогруппе U8b1. Образец V1.1.1 дал полиморфные сайты, соответствующие его положению в гаплогруппе U8b1a2, из-за наличия переходов в положениях нуклеотидов 16172 и 16259, хотя диагностика переходов U8b1 в положениях нуклеотидов 16189 и 16234 не была идентифицирована в V1.1.1. Последовательности ДНК депонированы в GenBank (http://www.ncbi.nlm.nih.gov/genbank/) под номерами доступа KY198376-198382.

    При объединении частот трипольских митохондриальных гаплогрупп вертебы из настоящего исследования с данными [7] и визуализации наряду с 36 другими доисторическими популяциями Евразии от верхнего палеолита до бронзового века в пространстве главных компонент компонент 1 объяснил 37,75% дисперсии, а компонент 2 — 18. 2% дисперсии. На графике PCA трипольское население было помещено в кластер, представленный европейскими и западноазиатскими/анатолийскими неоэнеолитическими земледельческими популяциями (рис. 1), включая малоазийский неолит (AMN), анатолийский неолит (ANA), неолит с юга Парижа. Бассейн (GLN), Криш-Старчево из Хорватии и Венгрии (STA), Ранний неолит и энеолит Испании (ENS, EES), Линейная керамика из Центральной Европы и Венгрии (LBK, LBKT), Россен и Шёнинген из Германии (RC, SCG) , а также воронкообразные стаканы/TRB из Скандинавии (FBC) и Германии (Baalberge (BAC) и Salzmünde (SMC)).Группа немецких воронкообразных кубков Зальцмюнде (3 400–3 025 кал. до н.э. [22]), по-видимому, была наиболее близкой к TC популяцией на графике PCA.

    Рис. 1. PCA-график частот митохондриальной ДНК 37 евразийских популяций от верхнего палеолита до раннего бронзового века, включая трипольскую популяцию из Вертебы (TC, заштриховано).

    Неоэнеолитический кластер земледельческого населения Малой Азии и Европы обведен на графике. Аббревиатуры культур, размеры популяций и источники данных приведены в таблице S2.

    https://doi.org/10.1371/journal.pone.0172952.g001

    Обсуждение

    Разнообразие гаплогрупп мтДНК, обнаруженное в останках ТС в Вертебе, в целом типично для группы европейских неолитических земледельцев, ведущих свои материнские генетические корни из Анатолии с небольшой примесью или без примеси местных охотников-собирателей. В нашем исследовании мы не идентифицировали линии мтДНК в TC, которые обычно характеризуют европейских мезолитических охотников-собирателей или их палеолитических предшественников, за возможным исключением двух образцов, несущих U8.Эти результаты согласуются с представлением о том, что материнский генетический вклад мезолитических европейцев был минимальным в TC. Таким образом, любые устойчивые особенности краниологии, если они имеют генетическое происхождение, с большей вероятностью объясняются отцовским вкладом, который должен быть виден на уровне анализа всего генома.

    Анализ частоты мтДНК, представленный в этом отчете, выявил тесную генетическую связь на уровне мтДНК между TC и европейскими неоэнеолитическими сельскохозяйственными группами, особенно из Центральной и Северной Европы, включая представителей комплекса Funnel Beaker/TRB, таких как Funnel Beakers. из Скандинавии (FBC [23–27]), а также группы воронкообразных стаканов Баальберге (BAC) и Зальцмюнде (SMC) из центральной Германии (рис. 1).Как и TC, в группе FBC отсутствовали представители линий охотников-собирателей гаплогруппы U, таких как U5, в то время как компонент U5 в популяциях BAC и SMC составлял менее 5% разнообразия гаплогрупп мтДНК. Все три вышеупомянутые группы европейских воронкообразных стаканов имели представителей гаплогруппы H с частотой 25% или более, а также имели представителей гаплогрупп J и T2b. Популяции BAC и SMC также содержали особей, принадлежащих к гаплогруппе HV. Сходство в составе линий мтДНК между ТК и культурным комплексом воронкообразный стакан/TRB может быть результатом межгрупповых контактов из-за близости популяций TRB к территории ТК. К северо-западу от стоянки Вертеба, в верховьях бассейна Днестра и прилегающих территориях зафиксировано наложение поселений ТК и ТРБ, а в археологических памятниках имеются свидетельства контактов между двумя культурами [28]. Некоторые артефакты, найденные в Вертебе (глиняные пуговицы, перфорированные костяные пластины, массивный мегалит внутри пещеры напротив входа в пещеру, некоторые из них рассмотрены в [7]), можно рассматривать как влияние культурного горизонта Кубок на культурный комплекс Вертеба. .

    Географическая близость могла способствовать культурным и биологическим контактам между ТРБ и трипольскими группами на всем протяжении распространения ТК вдоль Карпатской дуги и до западной части НПР, обеспечив таким образом выход кубков в Северо-Причерноморские степи. Недавнее исследование выявило тесную генетическую близость энеолитических групп NPR, а также западных групп NPR Yamna раннего бронзового века с популяцией воронкообразных кубков Бернбурга (3100–2650 гг. До н.э.) из Германии [29]. Имеются также свидетельства того, что контакты с участием кубков и понтийских степных и лесостепных популяций потенциально распространялись дальше на восток в Понто-Каспийский регион в эпоху ранней бронзы (ЭБВ). Анализ мтДНК новосвободненской и майкопской культур (3700–3000 гг. до н.э.) из северных предгорий Кавказского хребта выявил линии мтДНК T2b и U8b1a2 [30], хотя они демонстрируют разные модели полиморфизма по сравнению с линиями T2b и U8b1a2, описанными для TC. (данный отчет) и древние земледельческие группы из Центральной Европы.В то же время артефакты новосвободной культуры предполагают влияние воронкообразных кубков [31]. Дополнительные образцы мтДНК из Новосвободной, Майкопа, Триполья и Северо-Причерноморской степи должны прояснить родство культур ЭБА с Северного Кавказа и Триполья и их генетическую связь с культурным горизонтом Beaker, а также степень влияния Beaker на генетический ландшафт. доисторического Понто-Каспийского региона.

    Среди обнаруженных линий мтДНК в популяции TC в Вертебе гаплогруппа T2b считается одним из генетических маркеров экспансии анатолийских демов в Европу в раннем неолите [22]. В то же время предки T2b могли присутствовать в Европе с позднего плейстоцена, хотя данные исследований современных и древних геномов мтДНК позволяют предположить, что его распространение в пределах Европы, вероятно, произошло в период раннего неолита [32]. Линия T2b также часто встречается в современных популяциях Карпатского бассейна. При изучении линий мДНК карпатских горцев [33] одна из особей, происходящих из Бильче Золотое, в трех километрах от Вертебы, несла идентичный паттерн полиморфизма от HVS-1 до V3.14.1. Другой человек из Бильче Золотое в том же исследовании носил линию мтДНК H5a, что свидетельствует о сохранении митохондриальных линий, полученных от европейских неолитических земледельцев, в местных популяциях в районе пещеры Вертеба. В то же время совпадение по происхождению трех образцов в этом исследовании (HV0 (16298), h2b и H5a) с тремя исследователями (таблица S3), скорее всего, случайное, по крайней мере, в последних двух случаях. Исследователь, несущий линию h2b, не имел контакта с образцом M5 ни на одном этапе исследования, а линия H5a была определена в HMS, но не смогла произвести H5a-диагностический полиморфизм в GVSU.

    Наличие представителей редкой в ​​Европе митохондриальной линии U8b1 можно рассматривать как дополнительное подтверждение связи между энеолитическим населением Вертебы и анатолийскими земледельцами. U8b1 — один из двух субкладов гаплогруппы U8. Другой субклад U8 — это гаплогруппа K, доминирующая митохондриальная линия у земледельцев раннего неолита из Леванта, Анатолии и Европы [34–37]. Линия U8b1b, идентифицированная в образце V3.15.1, разделяет образец полиморфизма HVS-1 с образцом анатолийского неолита Barcın [I0745/M11-363] из [36].В неолитической Европе члены субклада U8b1 были идентифицированы у прото-лендьельского человека из Венгрии [37] и представителя шенингенской группы из Германии [22]. В то же время гаплогруппа U8 была обнаружена в образцах верхнего палеолита из Европы [21,38]. Основываясь только на данных мтДНК и дополнительно учитывая неполноту данных о последовательности мтДНК для образцов TC, несущих U8 в этом отчете, мы не можем провести различие между анатолийским и палеолитическим европейским происхождением линий U8 в TC в настоящее время.

    Принимая во внимание данные, представленные здесь и в [7], представители клады H составляют 28,6% (4 из 14 образцов) состава митохондриальной линии в Вертебе, что сопоставимо с другими неоэнеолитическими европейскими земледельческими группами, но особенно близко к популяциям воронкообразных стаканов в Европе. Группа SMC Funnel Beaker показала, что 30% ее линий являются членами клады H, более половины из них принадлежат к гаплогруппе H5, в то время как доля H в группе BAC составляла 25% [22].Несмотря на небольшой размер выборки (n = 9) доступных линий мтДНК скандинавской группы FBC, пять из девяти (55,5%) митохондриальных линий группы были представлены членами гаплогруппы H [23–27]. В FBC и BAC также были представители гаплогруппы h2 [27]. Анализ современных геномов мтДНК связал происхождение основных подразделений клады H (h2, h4) с франко-кантабрийским регионом в доледниковый период и их последующее распространение по Европе в течение голоцена из Иберийского ледникового рефугиума [32]. ,39], хотя также предлагались модификации этого сценария с участием восточноевропейских ледниковых рефугиумов [33].Некоторые из самых ранних находок членов клады H в Европе, в том числе представителей h2 и h4, были сделаны в стоянках раннего неолита на северо-востоке Испании и юге Франции [40–42]. Археогенетические данные указывают на расширение основных подветвей гаплогруппы H, таких как линия мтДНК h2, из Западной Европы во второй половине неолита, таким образом, они не связаны напрямую с первоначальным распространением земледелия в Европе, а вместо этого что связано с распространением групп Beaker по субконтиненту [22,43].Частота гаплогруппы H и наличие h2 в линиях мтДНК, обнаруженных в популяции TC в Вертебе, еще больше усиливают генетическую связь между TC и популяциями культурного комплекса Beaker.

    Взятые вместе, материнские генетические линии, представленные в этом исследовании, убедительно доказывают, что трипольское население из Вертебы ведет большую часть своих материнских генетических предков от групп населения, которые принесли земледелие в Европу в эпоху неолита. Полногеномные данные должны дополнительно прояснить положение Триполья на генетической карте предыстории Евразии.

    Вспомогательная информация

    S3 Таблица. Линии мтДНК (гаплогруппы) и соответствующие полиморфизмы нуклеотидов в контрольных (HVR-1 и HVR-2, если имеются) регионах сотрудников археологии и антропологии (AAP), а также персонала генетики (GP) в лаборатории GVSU, которые непосредственно работали с образцами до к анализу ДНК.

    10.1371/journal.pone.0172952.s003

    (DOCX)

    Благодарности

    Авторы выражают благодарность М. Сохацкому за предоставление доступа к материалам пещеры Вертеба.Д.Р. является исследователем Медицинского института Говарда Хьюза.

    Вклад авторов

    1. Концептуализация: AGN IP ML.
    2. Контроль данных: AGN DR.
    3. Формальный анализ: АГН.
    4. Финансирование приобретения: AGN DR.
    5. Расследование: АГН НР СМ.
    6. Администрация проекта: AGN DR.
    7. Ресурсы: АГН ДР.
    8. Валидация: AGN DR NR SM.
    9. Письмо – первоначальный вариант: AGN.
    10. Написание – просмотр и редактирование: AGN IP ML DR NR SM.

    Каталожные номера

    1. 1. Хвойка ВВ. Каменный век Среднего Поднепровья. Тр XI Археологического съезда. 1909; 2: 789–812.
    2. 2. Мюллер Дж., Рассманн К., Видейко М., редакторы. Мегасайты Триполья и предыстория Европы: 4100–3400 гг. До н.э. Нью-Йорк, штат Нью-Йорк: Рутледж; 2016.
    3. 3. Видеойко М.Ю., редактор.Энциклопедия трипольской цивилизации. Киев: Укрполиграфмедиа; 2004.
    4. 4. Энтони ДВ. Новый подход к языку и археологии: усатовская культура и обособление прагерманцев. J Индоевропейский конный завод. 2008; 36: 1–51. Доступно: http://www.scribd.com/doc/26055198/A-New-Approach-to-Language-and-Archaeology
    5. 5. Збенович ВГ. Трипольская культура: столетие исследований. J Предыстория мира. 1996; 10: 199–241.
    6. 6. Дергачев В.А.Bestattungskomplexe der späten Tripolje-Kultur. Майнц-на-Рейне: П. фон Заберн; 1991.
    7. 7. Никитин АГ, Сохацкий М.П., ​​Ковалюх М.М., Видейко М.Ю. Комплексная хронология памятников и анализ древней митохондриальной ДНК из пещеры Вертеба – памятника трипольской культуры энеолитической Украины. Междисциплинарный археол Nat Sci Archaeol. 2010;1: 9–18. Доступно: http://www.iansa.eu/papers/IANSA-2010-01-02-nikitin.html
    8. 8. Никитин АГ. Биоархеологический анализ человеческих останков эпохи бронзы из Подолья Украины.Междисциплинарный археол Nat Sci Archaeol. 2011;2: 9–14. Доступно: https://iansa.eu/papers/IANSA-2011-01-nikitin.pdf
    9. 9. Потехина ИД. Антропологические материалы из могильника Маяки. В: Патокова Е.Ф., Петренко В.Г., Бурдо Н.Б., Полищук Л.Ю., ред. Памятники Трипольской культуры в Северо-Западном Причерноморье. Киев: Наукова думка; 1989. С. 125–133.
    10. 10. Потехина ИД. Население Украины в эпоху Неолита и раннего Энеолита по антропологическим данным.Киев: Национальная академия наук Украины; 1999.
    11. 11. Сегеда СП. Антропологический рысий творчества трипольской культуры. Нар Творчисть та Этногр. 2005 г.; 18–21.
    12. 12. Лилли М., Потехина И., Никитин А.Г., Сохацкий М.П. Первые свидетельства межличностного насилия в украинской трипольской земледельческой культуре: человек 3 из пещеры Вертеба, Белче Золотое. В: Гердау-Радонич К., МакСвини К., редакторы. Тенденции в биологической антропологии. Оксфорд: Книги Оксбоу; 2015.стр. 54–60.
    13. 13. Никитин АГ, Ньютон Дж.Р., Потехина ИД. Митохондриальная гаплогруппа C в древней митохондриальной ДНК из Украины расширяет присутствие восточно-евразийских генетических линий в неолитической Центральной и Восточной Европе. Джей Хам Жене. 2012; 57: 610–2. пмид:22673688
    14. 14. Кнапп М. , Кларк А.С., Хорсбург К.А., Матису-Смит Э.А. Установка сцены – строительство и работа в лаборатории древней ДНК. Энн Анат — Анат Анцайгер. 2012; 194: 3–6.
    15. 15. Сантос С., Монтьель Р., Англес Н., Лима М., Франкалаччи П., Мальгоса А. и др.Определение гаплогрупп митохондриальной ДНК европеоидов человека с помощью иерархического подхода. Гум Биол. 2004; 76: 431–53. Доступно: http://www.ncbi.nlm.nih.gov/pubmed/15481677 pmid:15481677
    16. 16. Эндрюс Р.М., Кубака И., Чиннери П.Ф., Лайтоулерс Р.Н., Тернбулл Д.М., Хауэлл Н. Повторный анализ и пересмотр кембриджской эталонной последовательности митохондриальной ДНК человека. Нат Жене. 1999; 23: 147. pmid:10508508
    17. 17. Дабни Дж., Кнапп М., Глок И., Гансауг М.Т., Вейхманн А., Никель Б. и др.Полная последовательность митохондриального генома пещерного медведя среднего плейстоцена, реконструированная из ультракоротких фрагментов ДНК. Proc Natl Acad Sci. 2013; 110: 15758–15763. пмид:24019490
    18. 18. Корлевич П., Гербер Т., Гансауге М.-Т., Хайдиняк М., Нагель С., Аксиму-Петри А. и др. Снижение микробного и человеческого загрязнения при извлечении ДНК из древних костей и зубов. Биотехнологии. 2015;59.
    19. 19. Роланд Н., Харни Э., Маллик С., Норденфельт С., Райх Д. Частичная обработка урацил-ДНК-гликозилазой для скрининга древней ДНК.Philos Trans R Soc B Biol Sci. 2014; 370: 20130624–20130624.
    20. 20. Хаак В., Лазаридис И., Паттерсон Н., Роланд Н., Маллик С., Ламас Б. и др. Массовая миграция из степи была источником индоевропейских языков в Европе. Природа. 2015; 522: 207–11. пмид:25731166
    21. 21. Fu Q, Meyer M, Gao X, Stenzel U, Burbano HA, Kelso J и др. Анализ ДНК раннего современного человека из пещеры Тяньюань, Китай. Proc Natl Acad Sci. 2013; 110: 2223–2227. пмид:23341637
    22. 22.Брандт Г., Хаак В., Адлер С.Дж., Рот С., Сечени-Надь А., Каримния С. и др. Древняя ДНК раскрывает ключевые этапы формирования митохондриального генетического разнообразия Центральной Европы. Наука. 2013; 342: 257–61. пмид:24115443
    23. 23. Мальмстрем Х., Гилберт МТП, Томас М.Г., Брандстрём М., Сторо Дж., Молнар П. и др. Древняя ДНК показывает отсутствие преемственности между неолитическими охотниками-собирателями и современными скандинавами. Карр Биол. 2009; 19: 1758–1762. пмид:19781941
    24. 24.Скоглунд П., Мальмстрем Х., Рагхаван М., Сторо Дж., Холл П., Виллерслев Э. и др. Происхождение и генетическое наследие неолитических земледельцев и охотников-собирателей в Европе. Наука. 2012; 336: 466–9. пмид:22539720
    25. 25. Скоглунд П., Мальмстрем Х., Омрак А., Рагхаван М., Вальдиосера С., Гюнтер Т. и др. Геномное разнообразие и примесь различаются у скандинавских собирателей и земледельцев каменного века. Наука. 2014; 344: 747–750. пмид:24762536
    26. 26. Мальмстрем Х., Линдерхольм А., Скоглунд П., Сторо Дж., Шедин П., Гилберт МТП и др.Древняя митохондриальная ДНК с северной окраины неолитической экспансии земледелия в Европе проливает свет на процесс дисперсии. Philos Trans R Soc Lond B Biol Sci. 2015;370: 20130373. pmid:25487325
    27. 27. Ли Э.Дж., Реннеберг Р., Хардер М., Краузе-Киора Б., Ринне С., Мюллер Дж. и др. Коллективные захоронения среди агро-скотоводческих обществ в Германии позднего неолита: перспективы древней ДНК. J Archaeol Sci. 2014; 51: 174–180.
    28. 28. Пелисяк А. Поселения культуры воронкообразных кубков в сравнении с другими неолитическими культурами в верхней и средней части бассейна Днестра.Избранные вопросы. Состояние исследований. Analecta Archaeol Ressoviensia. 2007; 2: 23–46.
    29. 29. Никитин А.Г., Иванова С., Киосак Д., Баджероу Дж., Пашник Дж. Подразделения гаплогрупп U и C охватывают линии митохондриальной ДНК курганных популяций эпохи энеолита – раннего бронзового века в западной части степей Северного Причерноморья. Джей Хам Жене. 2017;
    30. 30. Соколов А.С., Недолужко А.В., Булыгина Е.С., Цыганкова С.В., Шарко Ф.С., Груздева Н.М., и др. Шесть полных митохондриальных геномов людей раннего бронзового века на Северном Кавказе. J Archaeol Sci. 2016; 73: 138–144.
    31. 31. Недолужко А.В., Булыгина Е.С., Соколов А.С., Цыганкова С.В., Груздева Н.М., Резепкин А.Д., и соавт. Анализ митохондриального генома представителя новосвободненской культуры с использованием секвенирования нового поколения и его связь с культурой воронкообразных стаканов. Acta Naturae. 2014;6: 31–35. пмид:25093108
    32. 32. Пала М., Оливьери А., Ачилли А., Акчеттуро М., Метспалу Э., Рейдла М. и др. Сигналы митохондриальной ДНК позднеледниковой реколонизации Европы из ближневосточных рефугиумов.Am J Hum Genet. 2012; 90: 915–924. пмид:22560092
    33. 33. Никитин А.Г., Кочкин И.Т., Джун К.М., Уиллис К.М., Макбейн И., Видейко М.Ю. Изменчивость последовательности митохондриальной ДНК в бойковской, гуцульской и лемковской популяциях Карпатского нагорья. Гум Биол. 2009; 81: 43–58. пмид:19589018
    34. 34. Фернандес Домингес Э. Полиморфизм митокондриальной ДНК в антигуас-де-ла-Куэнка Средиземноморье. Университет Барселоны; 2006. Доступно: http://www.tesisenxarxa.сетка/ручка/10803/795
    35. 35. Фернандес Э., Перес-Перес А., Гамба С., Пратс Э., Куэста П., Анфрунс Дж. и др. Анализ древней ДНК 8000 г. до н.э. Ближневосточные фермеры поддерживают пионерскую морскую колонизацию материковой Европы в эпоху раннего неолита через Кипр и острова Эгейского моря. Генетика PLoS. 2014;10: e1004401. пмид:24

      0
    36. 36. Мэтисон И., Лазаридис И., Роланд Н., Маллик С., Паттерсон Н., Руденберг С.А. и др. Полногеномные закономерности отбора у 230 древних евразийцев.Природа. 2015; 528: 499–503. пмид:26595274
    37. 37. Сечени-Надь А., Брандт Г., Хаак В., Кирл В., Якуч Дж., Меллер-Рикер С. и соавт. Прослеживая генетическое происхождение первых фермеров Европы, можно получить представление об их социальной организации. Proc Biol Sci. 2015;282: 20150339. pmid:25808890
    38. 38. Posth C, Renaud G, Mittnik A, Drucker DG, Rougier H, Cupillard C, et al. Плейстоценовые митохондриальные геномы предполагают единственное крупное расселение неафриканцев и позднеледниковую смену населения в Европе.Карр Биол. 2016; 26: 827–833. пмид: 26853362
    39. 39. Торрони А., Ачилли А., Маколей В., Ричардс М., Бандельт Х. Сбор плодов дерева мтДНК человека. Тенденции Жене. 2006; 22: 339–345. пмид:16678300
    40. 40. Лакан М., Кейзер С., Рико Ф.-Х., Брукато Н., Таррус Дж., Бош А. и др. Древняя ДНК предполагает ведущую роль мужчин в распространении неолита. Proc Natl Acad Sci. 2011; 108: 18255–18259. пмид:22042855
    41. 41. Лакан М., Кейзер С., Рико Ф.-Х., Брукато Н., Дурантон Ф., Гулен Дж. и др.Древняя ДНК показывает распространение мужчин через неолитический средиземноморский путь. Proc Natl Acad Sci. 2011; 108: 9788–9791. пмид:21628562
    42. 42. Гамба С., Фернандес Э., Тирадо М., Дегийу М.Ф., Пемонж М.Х., Утрилла П. и др. Древняя ДНК иберийского населения эпохи раннего неолита подтверждает первопроходческую колонизацию первыми земледельцами. Мол Экол. 2012; 21: 45–56. пмид:22117930
    43. 43. Браттон П., Хаак В., Темплтон Дж., Брандт Дж., Субриер Дж., Джейн Адлер С. и др. Неолитические митохондриальные геномы гаплогруппы H и генетическое происхождение европейцев.Нац коммун. 2013;4: 1764. pmid:23612305

    (PDF) Общество и технологии эпохи неолита и энеолита Балкан

    30 Habitus? Социальное измерение технологий и трансформации

    Подходы к датированию и культурной динамике в 6-4 тысячелетии до нашей эры.

    Rahden/Westf.: Verlag Marie Leidorf GmbH, 173-86.

    Црнобрня, А., Симич, З. и Янкович, М. 2009. Поселение поздней винчанской культуры в

    Црквине в Стублине.Старинар 59, 9-25.

    Эрл, Т. 2018. Введение: Ремесленники, технологии и потребители – политический

    экономический подход к ремесленной специализации, в: Милоглав, И. и Вукович, Дж. (ред.).

    Правило ремесленников: стандартизация продукции и специализация ремесел в доисторические времена

    Общество. Ньюкасл-апон-Тайн: издательство Cambridge Scholars Publishing, 1–19.

    Фейнман Г.М. 2011. Размер, сложность и организационные различия: сравнительный подход

    .Межкультурные исследования 45, 37-58.

    Гарашанин, М. 1982. Каменный век в районе Центральных Балкан, Древний Кембридж

    История 3(1). Кембридж: Издательство Кембриджского университета, 75-135.

    Гарашанин, М. 1997. Der späte balkanisch-antatolische Complex. Ein Rückblick nach

    Vier Jahrzehnten. Старинар 48, 15-31.

    Гринфилд, Х. Дж. 1999. Истоки металлургии: отличить камень от металла

    Порезы на костях из археологических раскопок.Журнал археологических наук

    26, 797-808.

    Холстед, П. 1995. От обмена к накоплению: неолитические основы Эгейского моря

    Общество бронзового века, в: Ланер, Р. и Нимайер, В.-Д. (ред.). Politeia: общество

    и государство в эпоху эгейской бронзы. Льеж: Льежский университет, 11-20.

    Холстед, П. 1999. Соседи из ада? Домохозяйство в неолитической Греции, в:

    Холстед, П. (ред.), Неолитическое общество в Греции.Шефилд: Sheld Academic Press,

    77-95.

    Холстед, П. 2006. Что наше, то мое? Деревня и домохозяйство в раннеземледельческом обществе

    в Греции; gehouden voor de Stichting Nederlands Museum voor Anthropologie en

    Praehistorie te Amsterdam op 3 ноября 2006 г. Амстердам: Stichting Neder-

    lands Museum voor Anthropologie en Praehistorie.

    Хенрих, Дж. 2004. Демография и культурная эволюция: как адаптивные культурные

    процессы могут привести к неадекватным потерям: пример Тасмании.American

    Antiquity 69(2), 197-214.

    Хервелла, М., Ротеа, М., Изагирре, Н., Константинеску, М., Алонсо, С., Иоана, М., Лазар,

    К., Ридиче, Ф., Сочару, А.Д., Нетеа, MG и де-ла-Руа, К. 2015. Древняя ДНК

    из Юго-Восточной Европы раскрывает различные события раннего и среднего

    неолита, влияющие на европейское генетическое наследие. PLoS ONE 10(6), e0128810.

    Хейд, В. и Уокер, К. 2015. Первые изделия из металла и выражение социальной власти,

    в: Фаулер, К.и другие. (ред.). Оксфордский справочник неолитической Европы. Оксфорд:

    Издательство Оксфордского университета, 673-91.

    Honch, NV, Higham, T., Chapman, J., Gaydarska, B. and Hedges, R. 2006. Палео-

    диетическое исследование углерода (13 C/12 C) и азота (15 N/14). N) в костях человека

    и фауны из могильников эпохи энеолита Варна I и Дуранкулак,

    Болгария. Журнал археологических наук 33 (11), 1493-504.

    Иванова М. 2012.Опасные воды: ранняя морская торговля вдоль западного побережья

    Черного моря (пятое тысячелетие до н.э.). Оксфордский археологический журнал 31 (4), 339–65.

    Йованович, Б. 1971. Металлургия эпохи энеолита в Югославии. Археолошки

    Институт: Белград.

    Kraus, R. 2008. Karanovo und das südosteuropäische Chronologiesystem aus

    heutiger Sicht. Евразия Антиква 14, 115-47.

    Краус Р., Шмид К., Абеле Дж.

    Добавить комментарий

    Ваш адрес email не будет опубликован.