Блюмкин и пакистан: «Такой молодой, глупый» – Огонек № 18 (5563) от 13.05.2019

Содержание

«Такой молодой, глупый» – Огонек № 18 (5563) от 13.05.2019

Яков Блюмкин — фигура мифическая. Воспоминаний, в которых не тиражировались бы легенды о нем, почти нет. Редкое исключение — неожиданные мемуары Юлия Лабаса, главу из которых публикует «Огонек»

В гигантской мастерской мама поселилась не одна: вселила подруг — Еву Розенгольц, Лену Прибыловскую и уж не помню, кого еще. Жили общим скудным хозяйством. Следует заметить, что в дом ВХУТЕМАСа эпизодически наведывались куратор ВЛКСМ (и, надо полагать, ОГПУ) Александр Николаевич Цацулин и меценатствующий чекист, в прошлом подозрительно быстро прощенный большевиками убийца немецкого посла Мирбаха Яков Григорьевич Блюмкин, наш резидент в Стамбуле, перед тем — кровавый подавитель восстания барона Унгерна в Монголии и участник попытки разжечь революцию в Иране, а еще, то ли правда, то ли миф, спутник художника Н. Рериха — искателя Шамбалы. Кто знает, не существовал ли тогда план разжечь пролетарскую революцию даже в Тибете?! Впрочем, по некоторым слухам, Блюмкин, переодетый ламой, сопровождал Рериха с особым заданием ОГПУ: отыскать Шамбалу и выведать у мифических духовных владык способ гипнотического воздействия на человеческие толпы, вроде того, которым владел сказочный гюлленский крысолов.

Позже с той же самой целью по Тибету тщетно рыскали нацистские шпионы. Гитлер ведь вполне серьезно верил в существование каких-то «князей ужаса», которые диктуют из Шамбалы историю всему человечеству. Однако у нацистов этот мистический бред хотя бы не шел вразрез с их теорией. Они ведь не штудировали «Диалектику природы» Ф. Энгельса и не величали себя «материалистами» в отличие от большевиков!

А до революции губастый чернявый мальчик Яша Блюмкин был эсер-максималист, а заодно полиглот, поэт-имажинист и, после многократных смен занятий в Одессе, книгоноша в питерской «Лавке писателей». Он добывал книжные раритеты для библиофила А. Грановского. Откуда и пошло злополучное знакомство сестер Идельсон (младшая, Раиса Идельсон, во втором браке была замужем за Александром Лабасом.—

«О») с этой эксцентричной особью.

В Октябрьскую революцию эсеры-максималисты действовали заодно с большевиками. Вместе брали Зимний, разгоняли «Учредилку». Но вдруг в вопросе Брестского мира возникли разногласия. Эсеры были за продолжение войны, а большевики — за мир любой ценой, имея в виду территории.

Результатом стало провокационное убийство немецкого посла эсером Блюмкиным и бунт левых эсеров, подавленный большевиками с необычайной жестокостью.

Блюмкин был тогда в личной охране Ф.Э. Дзержинского. Он бежал и бесследно исчез. Поиски ЧК оказались тщетными. Таковы исторические псевдофакты. Мы все это знаем из советских учебников.

А как на самом деле? В июле 1918-го Блюмкин явился в немецкое посольство не один, а с неким громилой-матросом Николаем Андреевым. Толовая бомба Блюмкина не взорвалась. Сам он, убегая, зацепился штанами за железную ограду. Андреев хладнокровно ухлопал Мирбаха из «маузера», снял с ограды Яшу Блюмкина, и вместе они удрали на грузовике. ВЦИК решил: «Наш Яша хочет воевать с немцами. Пошлем его на Украину в партизанский отряд Щаденко». Так и сделали. А между тем был объявлен всероссийский розыск «исчезнувшего» Блюмкина! Покушение стоило свободы и жизни многим ни в чем не повинным левым эсерам.

Это была очередная, хорошо продуманная большевиками провокация с целью избавиться от надоевших союзников, и не более.

Тетя мне рассказала несколько любопытных эпизодов. В 1919 году Блюмкин, «прощенный» после покушения на Мирбаха, сидел в «Метрополе» и громко декламировал стихи Н. Гумилева. Вдруг в зал вошел Гумилев и спросил:

— Много вы знаете моих стихов?

— Все! — самоуверенно ответил Блюмкин.

— Мне лестно, что герой, известный террорист, столь высокого мнения о моих стихах,— ответил ему Гумилев и публично пожал Блюмкину руку.

Тогда еще для русской интеллигенции террористы не были «нерукопожатными» людьми! Позже в стихотворении Гумилева появилось упоминание о Блюмкине: «…Человек, среди толпы народа застреливший императорского посла, подошел пожать мне руку, поблагодарить за мои стихи…» А в другой раз (не помню, до или после убийства Мирбаха) в том же «Метрополе» Блюмкин важно восседал за отдельным столиком и просматривал какие-то списки. Подошел Осип Мандельштам:

— Яша, что читаешь?

— А, ерунда, расстрельные списки. Хочешь, и тебя впишу?

Мандельштам попросил у Блюмкина список и тотчас разорвал пополам, а потом бросился бежать. Блюмкин — за ним:

— Стой! Убью!

Мандельштам кинулся к покровительствовавшей ему мадам Каменевой. Каменева позвонила Феликсу Эдмундовичу и подозвала к телефону Мандельштама. Дзержинский вскричал:

— Позор! Мерзавец! Позорит знамя революции! Расстреляю!

Осип Эмильевич взмолился:

— Пощадите Яшу, он ведь такой молодой, глупый.

Блюмкину, видно, все-таки тогда досталось на орехи. Назавтра он бегал по Москве с пистолетом:

— Доносчик, негодяй! Застрелю!

Мандельштама предупредили. Он с перепугу решил в ту же ночь уехать в Питер. Вошел в вагон, занял место. И тут в тот же самый вагон входит… Блюмкин, зачем-то командированный в Петроград. С сардонической улыбкой снимает портупею с кобурой и демонстративно закидывает на верхнюю, вещевую, полку. Оба промолчали всю дорогу. В Петрограде, не прощаясь, разошлись в разные стороны. По крайней мере, так эту историю Блюмкин и жена Мандельштама, Надежда Яковлевна, однокашница моей матери, через несколько лет рассказали (в разных версиях) моей тете.

Ведь Яша тоже любил стихи Мандельштама.

В конце октября 1929 года глубокой ночью в нашей квартире 36 дома 21 по Мясницкой раздался звонок. Мать в одной рубашке подбежала к двери:

— Кто там?

— Откройте! Это я, Яша Блюмкин. За мной гонятся!

Его впустили с растерянностью и испугом. Кто гонится? Почему? Ведь Блюмкина все побаивались, зная, что он важный чекист.

Войдя, Блюмкин сбивчиво рассказал о том, что привез какие-то троцкистские инструкции, обращение к оппозиции, а также рассказал, что некий подчиненный командарма Тухачевского, роясь в архивах царской охранки, наткнулся на очень странную бумагу. Некто из членов ЦК большевистской партии настрочил в полицию донос на другого члена ЦК, депутата Думы и в то же время провокатора Малиновского. Что-де тот фактически занимается антигосударственной деятельностью и плохо справляется со своими прямыми (провокаторскими?!) обязанностями.

Автором доноса в охранку (подпись, если я не ошибаюсь, «Фикус») по всем признакам был не кто иной, как сам Коба, он же Иосиф Виссарионович Джугашвили!

Блюмкин все сгоряча выболтал дружку — Карлу Радеку (поляки его звали Карл Крадек, по-польски «Карл-вор») и собрался было по своим бумагам разведчика тотчас улететь на аэроплане обратно в Турцию, чтобы там передать фотокопию находки Льву Давидовичу Троцкому, пребывавшему тогда то ли в Стамбуле, то ли на Принцевых островах: «Если доверенные мне документы попадут к Троцкому, здесь власть перевернется!». Радек, однако, немедленно заложил Блюмкина, и теперь все пропало. Блюмкин метался по громадной квартире.

— Никому не открывайте дверь. Буду стрелять!

Потом он позвонил врачу Григорию Лазаревичу Иссерсону:

— Гриня, достань мне яд!

— Зачем тебе?

— Я завалил операцию, за мной гонятся, мне грозит расстрел!

— Так у тебя пистолет на боку.

— Из пистолета не могу.

— Других мог многократно. Что же себя не можешь?

— Себя не могу.

— А я не травлю людей, я их лечу,— спросонья сказал напуганный Иссерсон и бросил трубку.

Блюмкин как пойманный зверь метался по квартире:

— Жить! Жить хочу! Хоть кошкой, хоть собакой, но жить!

Под утро, после бессонной ночи, Блюмкин позвонил некоей Лизе (Лиза Горская, любовница Блюмкина и приставленный к нему соглядатай ОГПУ, в будущем подполковник ГРУ Зарубина).

— Лиза, приходи на Мясницкую и принеси мою шинель с Арбата — на улице холодно (на Арбате была квартира Блюмкина. Вот наивность!). Надеюсь, придешь ОДНА? Собеседница запротестовала, мол, конечно же, приду одна. Вскоре Блюмкин ушел, предупредив:

— Никому, кроме меня, не открывайте, скоро вернусь.

Блюмкин же больше не вернулся. В дверь громко застучали сапогами:

— Откройте: ОГПУ!

Вошли:

— Где вещи Блюмкина?

Студентки молча показали.

Назавтра всех студенток вызвали в ОГПУ к Мееру Абрамовичу Трилиссеру. Взяли подписку о невыезде. Между прочим, «уходя за шинелью», Блюмкин оставил в фальковской мастерской свое шикарное кожаное пальто «чекистского» покроя. (Через много лет мама с тетей подарили его бывшему директору ГОСЕТа Арону Яковлевичу Пломперу, вернувшемуся после лагерной отсидки домой.) А через неделю после ареста Блюмкина в квартиру вошел Цацулин (он заходил как-то к маме при мне после войны в серой мидовской форме):

— Девочки, будете жить. Блюмкин перед расстрелом рассказал, что ворвался к вам в квартиру, угрожая оружием, и ни с кем из вас не общался.

Трилиссера вскоре выгнали из ОГПУ, а гораздо позже, 2 февраля 1940 года, расстреляли. Были смещены со своих постов и затем расстреляны все три начальника Иностранного одела ОГПУ — НКВД, занимавших этот пост после Трилиссера. Раньше того, в 1936 году, был расстрелян и майор Штейн, по приказу Сталина и Ягоды тоже рывшийся в архивах охранки (ему было велено срочно отыскать там компромат на опальных вождей, обреченных на казнь в 1937-м) и, по слухам, откопавший вместо того, к своему ужасу, целую папку доносов товарища Кобы на своих соратников по партии. К папке было приколото фото. Заодно расстреляли все чекистское начальство Штейна и почти поголовно весь высший комсостав РККА, в первую очередь участников Гражданской войны.

Кто знает, может быть, и вся сталинская паранойя развивалась на почве безумного страха разоблачения его как бывшего провокатора — платного агента царской охранки?

Любого открывшего чемоданчик Блюмкина и просмотревшего лежавшие в нем взрывоопасные документы, несомненно, ждала смерть.

Не исключаю, что содержимое чемоданчика (тем более папку, раскопанную майором Штейном) чекисты поспешили засунуть в какой-то сейф и просто боялись вскрыть или уничтожить при свидетелях. Риск любых действий с документами подобного рода, учитывая тогдашнюю бюрократическую отчетность и взаимное соглядатайство в ОГПУ, был равновелик. А во время гражданской войны в Испании туда выехал резидент иностранного отдела НКВД Александр Михайлович Орлов (Лев Лазаревич Фельдбин). Оттуда он бежал в США и увез с собой кое-какие документы, которые там положил в банк и завещал опубликовать через 40 лет после его смерти (последовавшей в 1973 году). Условием была безопасность стариков-родителей, оставшихся в СССР. Известно, что родителей Орлова, в отличие от тысяч других членов семей «врагов народа», не тронули. А наш шпион Михаил Александрович Феоктистов уже при Брежневе дважды отыскал квартиру постоянно ее менявшего Орлова в США и получил заверение, что документы не будут обнародованы раньше вышеозначенного срока.

Архив номеров

 Уважаемые друзья!
Сейчас мы все переживаем непростые времена. Кризис затронул все области жизни, включая и без того непростую ситуацию для пока ещё выходящих в виде «бумажных» изданий независимых средств массовой информации. «Совершенно Секретно» не имеет спонсоров и существует только за счёт тех денег, что платят за газету наши читатели. Любая помощь и поддержка важна для нас.
Оказать её очень легко — отсканируйте данный QR-код в мобильном приложении, к примеру, «Сбербанка» (заплатить по QR- коду) или любого другого приложения любого банка, поддерживающего платежи по QR-коду, и вы сможете сделать пожертвование. И самое главное не забывайте подписываться на бумажную версию «Совсека». Мы обещаем, что с нами будет интересно.

 Откройте (запустите) банковское приложение, отсканируйте QR-код, выбрав пункт меню «платежи по QR-коду» и наведя камеру на QR-код, введите сумму пожертвования и сделайте платёж.

                                                              

E-mail редакции: [email protected] com

 

Тел./факс редакции: +7 (499) 288-00-72

Whatsapp: +7(985)189-28-20
Viber: +7(985)189-28-20
Telegram: +7(985)189-28-20

                                                                                                                                                                                           

Рекламный отдел:+7 (499) 288-00-72                                                                                                                  

[email protected]                                                                                                                                                                              

Отдел распространения: +7 (499) 288-00-89

[email protected]       

                                                              

 

  *Экстремистские и террористические  организации, запрещенные в Российской Федерации:                 

 «Правый сектор», «Украинская повстанческая армия» (УПА),«ИГИЛ», «Джабхат Фатх аш-Шам» (бывшая «Джабхат ан-Нусра», «Джебхат ан-Нусра»), Национал-Большевистская партия (НБП), «Аль-Каида», «УНА-УНСО», «Талибан», «Меджлис крымско-татарского народа», «Свидетели Иеговы», «Мизантропик Дивижн», «Братство» Корчинского, «Артподготовка», «Тризуб им. Степана Бандеры», «НСО», «Славянский союз», «Формат-18».

18+

Учредитель: ООО «Совершенно Секретно Трейд».
Юридический адрес: 127247, г. Москва, Дмитровское ш-е, д. 100, стр. 2.
Почтовый адрес: 127247, г. Москва, а/я 72.
Генеральный директор: Андрей Кораблин.

 

Все права защищены. Копирование и использование материалов запрещено, частичное цитирование возможно только при условии гиперссылки на сайт.

Яков Блюмкин – «любовник революции»

То, что Блюмкин был большим авантюристом, и то, что на его руках немало крови, неоспоримо. Но… не знаю, кем мог бы стать этот, бесспорно, талантливый человек, если бы ему не начала строить глазки г-жа Революция. Именно она вылепила из своего «любовника» того, кем он стал. Революция катастрофично и безжалостно ломает судьбы миллионов людей. Ломает изощренно, умудряясь даже романтика превратить в палача.  

К тому же Блюмкин не просто был поклонником Троцкого, в чем, кстати, нет ничего удивительного, эта личность, как магнит, одних отталкивала, а других притягивала. В показаниях Блюмкина — а арестовали его как раз за контакты со Львом Давидовичем в Константинополе — хорошо видно, как он мечется между верностью партийной дисциплине и тем, что многое в установках того, уже сталинского времени ему не по душе. Изо всех сил пытался быть верным и ВКП(б), и не предать Троцкого.  

Из показаний Блюмкина, где он рассказывает о своих спорах (незадолго до ареста) с Маяковским: «В ходе этой пикировки… Маяковский бросил мне фразу: «Не задирайтесь. Я помню, Блюмочка, когда вы секретарем были», намекая, что я работал у Троцкого. На это ответил следующее: «Секретарем не был, а состоял для особо важных поручений при человеке, которого сидящий здесь Кольцов (известный советский журналист) называл одним из самых аналитических и острых умов Октябрьской революции» и «что я надеюсь, что он еще будет с нами, и мы еще будем вместе».

Из-за этих внутренних метаний и попался. Человеку, который умел быть «своим среди чужих», было невыносимо трудно оказаться «чужим среди своих».

Пошел за советом к Радеку, хотя  должен был понимать, что это за личность. Трусоватый и изворотливый Радек, разумеется, страшно испугался. И есть версия, что именно он сдал Блюмкина. Возможно.  

Блюмкин открыл душу женщине, хотя мог бы просчитать, куда она побежит после разговора. Вот ее подробнейшие донесения в деле Блюмкина точно есть. Впрочем, это была необычная женщина. Елизавета Горская, она же Зарубина (есть и другие имена и фамилии), стала позже подполковником госбезопасности и где только за рубежом не работала. И очень успешно. Так что это был крепкий орешек, который не так-то просто раскусить. Но и доверяться ей не было ни малейшей нужды, просто Блюмкину невыносимо хотелось хоть с кем-то поделиться своими сомнениями. Опытный разведчик метался в тот период абсолютно непрофессионально. Просил малознакомых людей обменять доллары, не скрывая, что их у него целая сумка, пытался уехать из Москвы на поезде, толком не узнав расписания, боялся ареста и при этом встречался у себя дома с троцкистом.   Написал покаянное письмо в ГПУ, но так его и не отправил. 

Мифические страны — Шамбала — Часть 2

Такое название присваивают обычно роскошным отелям, ресторанам, горным курортам и прочим «райским уголкам» на Земле, а президент Рузвельт даже назвал так свою летнюю резиденцию в горах Мэриленда (впоследствии переименована в Кэмп-Дэвид).Купить угловой диван диван офисный. Возможно ли существование в наше где-нибудь в недоступной горной долине Тибета подобного эзотерического братства, хранящего неведомые остальному человечеству знания? Вряд ли… Во всяком случае можно сильно сомневаться, что такое братство существует на тщательно контролируемой Китаем территории Тибетского автономного района.

И потому нынешние эзотерики и исследователи аномальных явлений все чаще говорят о Шамбале «невидимой» — скрытой в подземных пещерах или в «»… В то же время ученые продолжают поиск страны, послужившей прообразом мифической Шамбалы. На сегодняшний день существует несколько гипотез относительно возможного местоположения буддийского «парадиза» на картах древнего мира. Например, отдельные исследователи связывают Шамбалу с процветавшими в VII-X веках нашей эры буддийскими городами-государствами Таримского бассейна в Восточном (Китайском) Туркестане, где некогда пролегал Великий шелковый путь.

Другой регион поисков — обширная территория между Ираном и западной Индией. Согласно гипотезе российского тибетолога Б. И. Кузнецова, Шамбала — это древний Иран эпохи Ахеменидов (VI-IV в, до н. э.). К такому неожиданному выводу ученый пришел в результате расшифровки древней географической карты из тибетско-шаншунского словаря 1842 года. Термин Шамбала, как утверждает Кузнецов, использовался индийцами для названия Ирана и может быть переведен как «держатели мира (блага)». Из Ирана же индийцы заимствовали и учение о Бесконечном Времени (Зерван Акарана), которое затем было положено в основу буддийской системы Калачакра.

Предполагается, что такое учение было создано западными иранскими магами под влиянием древней вавилонской традиции, согласно которой история делится на большие временные циклы и внутри каждого из них все события периодически повторяются. Современный английский путешественник-исследователь Чарльз Аллен помещает Шамбалу в западном уголке Тибета, вблизи священной горы Кайлас — там, где возникла первая тибетская цивилизация и вместе с ней загадочная религия левосторонней свастики «бон». Именно в этих местах сложилась бонская легенда о райской земле Олмо-лунрин, которую индийцы позднее окрестили Шамбалой. Что касается учения о Калачакре, то оно, как полагает Аллен, происходит из древней Гандхары (территория, охватывающая северный Пакистан и восточный Афганистан). Одна из областей Гандхары — Уддияна, которую обычно отождествляют с живописной долиной Сват, расположенной среди южных отрогов Гиндукуша на севере Пакистана, считается колыбелью тантрического буддизма.

Посетивший эту долину в 629 году китайский паломник Сюань Цзан с удивлением обнаружил там остатки почти полутора тысяч (!) различных буддийских памятников (монастыри, ступы) и поселений, что свидетельствовало о сказочном расцвете буддизма в Уддияне в предшествующую эпоху (II-V века). «Можно представить себе,- пишет Аллен,- каким уголком должна была казаться эта долина обитавшим в ней буддистским монахам».Думаете где продается ?

Helen Marlen — брендовая одежда для детейПосле завоевания Гандхары белыми гуннами Калачакра-тантра переместилась в регион западных Гималаев. Версия английского ученого, умело увязывающего древние буддийские и бонские предания с реальными историческими фактами и рисующего весьма достоверную картину «странствий» Кала-чакра-тантры по странам Центральной Азии и ее постепенной трансформации, весьма интересна, при этом стоит обратить внимание на тот факт, что Аллен локализует Шамбалу именно там, куда ее обычно помещают различные эзотерики, — в западной части Тибета. Что касается самих тибетских лам, то они придерживаются самых разных точек зрения: одни считают, что Шамбала находится (поныне!) в Тибете или же в горной системе Куньлуня, возвышающейся над Тибетским плато, другие — в соседнем Синьцзяне (Западном Китае), однако большинство из них верит, что Шамбала расположена в гораздо более северных широтах — в Сибири или в каком-то другом месте России или даже в Арктике (?!). Однако большинство нынешних исследователей предпочитают утверждать, что Шамбала не имеет отношения к истории или географии. Шамбала — это вера в лучшее будущее.

И как символ этой веры может быть использована для борьбы с настоящим. Согласно древней тибетской карте в словаре «Tibetan — Zang Zung Dictionary. Delhi, Tibetan Bon Foundation», которую смогли интерпретировать советский тибетолог Б. И. Кузнецов и востоковед Л. Н. Гумилёв, такая страна существовала. Карта восходит к ирано-тибетской картографической традиции.

Согласно этой интерпретации, автор был современником Селевкидов и отразил на карте эпоху господства Сирии, руководимой завоевателями. Сирия по-персидски называется Шам, а слово «боло» означает «верх», «поверхность». Следовательно, Шамбала переводится как «господство Сирии», что и соответствовало действительности в период III—II в. до н. э.

В теософской традиции Шамбала — место нахождения Великих Учителей, продвигающих эволюцию человечества. Находится в высших вибрациях, и поэтому невидима и недоступна для непросветленного человека. Подробно описана в работах Николая и Елены Рерих — «Учение Живая Этика (Агни-Йога)». По одной из легенд 144 тысячи лет господствовала на Земле в незапамятные времена Великая Всемирная Федерация народов. Благодаря накопленным в ней знаниям царил на планете нашей Золотой век. Но, овладев универсальными знаниями, научившись творить чудеса, люди стали считать се6я выше Бога. Они создали идолов-великанов и заставили их служить себе, а потом разрешили идолам брать в жены дочерей своих. «И увидел Господь, что велико развращение человеков на Земле, и что все мысли и помышления сердца их были зло во всякое время. И раскаялся Господь что создал на Земле, и воскорбел в сердце своем» (Книга Бытия, гл.

б, стих 5, 6). И сделал так, чтобы темные быстрые воды очистили Землю от скверны и гордыни человеческой. Единственным местом, которое не затронул , стал небольшой участок горных вершин. А девять тысяч лет назад те, кто уцелел, попытались возродить Федерацию. Так появилась в глубине Азии, на границе Афганистана, Тибета и Индии страна чародеев Шамбала, страна махатм («великая «). Восемь снежных вершин, как лепестки лотоса, окружают ее. Великие вожди чародеев скрыли страну от всевидящего ока Господа кольцом густых туманов, а новым землянам, населившим планету, передали: «Географ пусть успокоится — мы занимаем на Земле свое место. Можно обыскать все ущелья, но непрошеный гость путь не найдет».

Много раз, но безуспешно, пытались люди отыскать таинственную страну, завладеть секретными знаниями. Правительства многих стран — Англии, Франции, Германии, Китая — снаряжали экспедиции в глубь Азии. Но ближе всех подобрался к Шамбале Советской России. Поздним ноябрьским вечером 1924 года в квартиру сотрудника Института и высшей нервной деятельности Александра Барченко вошли четверо в черном.

Один из посетителей, представившись Константином Владимировым (рабочий псевдоним Якова Блюмкина), сообщил хозяину, что его опыты по заинтересовали органы ОГПУ, и, многозначительно улыбаясь, попросил написать отчет о своей работе на имя Дзержинского. Опешивший Барченко пытался что-то возразить, но мягкий, льстивый голос улыбающегося человека заставил его не только согласиться с предложением, но еще и с гордостью рассказать о своих новых опытах. Особое впечатление на мужчин в черном произвели фиксация мысли на расстоянии и летающий стол — тот самый стол, за которым сидели посетители, оторвался от пола и повис в воздухе! Отчет об опытах Барченко Дзержинскому передал лично в руки Яков Блюмкин. Высокий начальник, заинтригованный устным рассказом очевидца, передал отчет сотруднику секретного отдела Якову Агранову.

Шамбала-страна секретных знаний — ДЛЯ ВСЕХ И ОБО ВСЕМ — LiveJournal


Первыми о загадочной стране поведали португальские миссионеры-иезуиты Эстебан Качелла и Жоао Кабрал. В 1628 году, пытаясь пройти из Бутана в Катай (Cathay), то есть в Китай, о котором в то время имелись довольно скудные сведения, они узнали о существовании неведомой им страны — «Ксембала» (Xembala).
Бутанский правитель сообщил им, что это очень известная страна и что она граничит с другим государством под названием Согпо.

Из такого ответа Качелла заключил, что Ксембала — это и есть Катай, поскольку сообщенные ему сведения — огромные размеры Ксембалы и ее соседство с владениями монголов — соответствовали тому, как Катай-Китай изображался на географических картах.
После этого Качелла предпринял путешествие в Ксембалу, и ему удалось добраться до города Шигадзе во владениях Панчен-ламы (то есть в Тибете). Сюда в начале 1629 года из Бутана прибыл и его спутник Кабрал.
Путешественники, однако, довольно быстро сообразили, что попали не в Катай, а в страну, которая на европейских картах того времени именовалась Большой Татарией.

Другой европейский путешественник — венгр Чема де Кереши, побывавший в Бутане и Тибете в начале XIX века, дополнил сведения португальских монахов. В небольшой статье, опубликованной им в 1833 году в журнале Азиатского общества Бенгалии, Кереши, в частности, сообщает, что Шамбала — это «мифическая страна, расположенная на севере» и что ее столицей является Калапа — «прекрасный город, резиденция многих прославленных царей Шамбалы».
Называя Шамбалу «мифической страной», де Кереши тем не менее указывает относительно точные ее географические координаты — «между 45 и 50 градусами северной широты, за рекой Сита или Яксарт».

Все эти скупые сведения о Шамбале долгое время оставались достоянием узкого круга географов и востоковедов. И только во второй половине XIX века благодаря теософскому учению Елены Петровны Блаватской предание о Шамбале становится известным широкой публике.

Составляя единую эзотерическую доктрину — «первоначальное откровение, данное человечеству», — Блаватская обратилась к древнейшим мистериальным культам и учениям, сохранившим, по ее мнению, остатки древней традиции. В своем капитальном труде «Тайная доктрина» Елена Блаватская (со ссылкой на публикации Чема де Кереши и сообщения немецких путешественников по Тибету братьев Шлагинтвейт) упоминает о Шамбале и о священной книге «Дус-Кьи-Хорло» («Цикл Времени»).
Содержащаяся в этой книге система тибетского мистицизма, по утверждению Блаватской, столь же древняя, как и человек, практиковалась в Индии и Тибете задолго до того, как Европа стала континентом (!), хотя первые сведения о ней появились только около тысячелетия назад.

«В глуши Транс-Гималаев, — пишет Блаватская, — слишком общо называемых Тибетом, в наиболее недоступных местах пустынь и гор до сегодняшнего дня живет эзотерический «Благой Закон» — «Печать Сердца» — во всей своей первоначальной чистоте».
Шамбала для Блаватской и ее последователей — это уже не «мифическая страна» Дэджунг (Источник счастья), а некое реально существующее братство или община посвященных йогов-махатм.
Таких мистических братств, хранящих остатки древней Универсальной науки, на Земле существует немало, однако они не имеют никакого отношения к так называемым цивилизованным странам. Более того, местонахождение их должно оставаться тайной для остального мира — до тех пор, пока «человечество в массе своей не очнется от духовной летаргии и не раскроет свои слепые очи навстречу ослепительному свету Истины».

Листая «Тайную доктрину», мы встречаем и другие упоминания о Шамбале. В рамках довольно сложной хронологии истории Земли, описанной Блаватской, этой стране, сокрытой в подземных пещерах, тоже нашлось место.
Вот лишь несколько цитат из Елены Блаватской: «…Лишь горстка этих Избранных, Божественные наставники которых удалились на «Священный Остров», откуда придет последний «спаситель», — удерживала теперь половину человечества от истребления ее другой…»
«…Многочисленные пещеры и руины, обнаруживаемые в обеих Америках, а также на Вест-Индских островах, все они связаны с затонувшей Атлантидой. В то время как иерофанты Старого Света во времена Атлантиды были связаны с Новым Светом наземными путями, маги несуществующей теперь страны имели целую сеть подземных коридоров, расходящихся по всем направлениям…»

«…Мы намекаем не на пещеры, известные каждому европейцу, будь то наяву или же понаслышке, несмотря на их огромную древность, хотя даже это оспаривается современной археологией; но на факт, известный всем посвященным браминам Индии и особенно йогам, — именно, что нет ни одного пещерного храма в этой стране, который не имел бы своих подземных проходов, расходящихся по всем направлениям, и что эти подземные пещеры и бесконечные коридоры, в свою очередь, имеют свои пещеры и коридоры…»
В представлениях Блаватской Шамбала — это последнее убежище уцелевших в мировой катастрофе представителей расы атлантов.
Современные теософы разделяют это представление, рассказывая о Шамбале так (цитируем по сборнику работ современных теософов, подготовленному Надеждой Уриковой):

«Тысячи сказаний всех народов на протяжении веков передаются из уст в уста о легендарной Обители Великого Белого Братства — Шамбале. Шамбала — не слухи, она действительно существует. «Не думайте, что Братство Наше скрыто от человечества непроходимыми стенами. Снега Гималаев, скрывающие Нас, не препятствуют для идущих в правде, но не для исследователей». Так говорит Владыка Шамбалы на страницах «Живой Этики».

Наукой установлено, что лживых легенд не существует. О малом, о незначительном, о жалком человечество не слагает легенды. Легенды — не отвлеченность, но сама реальность. Они говорят о том, что Белое Братство, Великие души пришли на Землю на заре существования человечества с более высоких планет — Юпитера и Венеры, где духовное развитие человечества шло быстрее. Они окончили свою эволюцию, но пошли на сознательную жертву, чтобы удержать планету от гибели, чтобы облегчить духовный прогресс человечества.

Великие знания, истинные ценности хранятся в гигантских книгохранилищах Братства, расположенных в недоступных пещерах под Землей для защиты сокровищницы культур не только от грабителей, но и от геологических катастроф.
Там хранится наследие затонувшей Атлантиды, ошеломляющие достижения исчезнувших цивилизаций, существовавших тысячелетия назад. …Учителя Шамбалы постоянно шлют мысли, идеи, направленные на рост духа людей, великие открытия. Все в умственном, нравственном и культурном развитии человечество получает из Единого Источника, оно всегда черпает мощь из Великого Белого Братства. Огромна работа Братьев Шамбалы.

Ведется борьба против невежественного эгоизма, негативного мышления в инертной массе человечества, чтобы изменить ее в высшие формы законов эволюции. Они частично нейтрализуют темную ауру Земли, содержащую вредоносные мысли с первых дней существования человечества».

Но тут благостная картинка вдруг сменяется неприкрытыми угрозами:
«…Владыки Шамбалы, которые получили знания раньше нас и знают гораздо больше, предупреждают, что нынешний кризис будет сильнее предыдущих катаклизмов, ибо население планеты растет, а его духовность падает.
Единственное, что может спасти, — Учение Сердца — Живая Этика, духовное совершенствование. Человечество должно выбрать. Если люди будут продолжать идти прежним «материальным» путем, то лучезарный глава Шамбалы уничтожит все зло на планете.
Руководители Шамбалы заговорят молниями. Пришла Эра Шамбалы».

Подобные идеи нам знакомы. Уж очень теософы не любят науку и материалистический взгляд на мир — отсюда и ярость благородная», и обещание показать «кузькину мать» оппонентам.
Но пусть их, теософов, — в конце концов они имеют весьма отдаленное отношение к Шамбале. И на вопросы о таинственной стране, в которой проживают носители древнего знания, не дают сколько-нибудь удовлетворительного ответа. Поговорим лучше о тех, кто попытался это сделать, не дожидаясь прихода Ригдена Джапо.
Предание о Шамбале в его европейском варианте получило дополнительное развитие после публикации осенью 1933 года романа-утопии английского писателя Джеймса Хилтона «Потерянный горизонт».
В этом произведении Хилтон необычайно увлекательно и правдоподобно изобразил расположенный в одной из труднодоступных горных долин на территории западного Тибета буддийский монастырь-«ламасерию» Шангри-ла, населенный представителями различных народов, в том числе и европейцами.

Благодаря тайным знаниям и оккультным методикам обитатели монастыря сумели подчинить себе ход времени, замедлив его течение.
Они живут замкнутой общиной — мирно и счастливо, погрузившись в занятия науками и искусством, не ведая тревог и забот, терзающих остальное человечество.
Роман Хилтона в короткое время приобрел большую популярность на Западе, многократно переиздавался и в 1937 году был экранизирован.
С легкой руки Хилтона слово «Шангри-ла» прочно вошло в английский язык в значении «воображаемый земной рай, убежище от тревог современной цивилизации». Такое название присваивают обычно роскошным отелям, ресторанам, горным курортам и прочим «райским уголкам» на Земле, а президент Рузвельт даже назвал так свою летнюю резиденцию в горах Мэриленда (впоследствии переименована в Кэмп-Дэвид).
Возможно ли существование в наше время где-нибудь в недоступной горной долине Тибета подобного эзотерического братства, хранящего неведомые остальному человечеству знания?
Вряд ли…

Во всяком случае можно сильно сомневаться, что такое братство существует на тщательно контролируемой Китаем территории Тибетского автономного района. И потому нынешние эзотерики и исследователи аномальных явлений все чаще говорят о Шамбале «невидимой» — скрытой в подземных пещерах или в «параллельном мире»…
В то же время ученые продолжают поиск страны, послужившей прообразом мифической Шамбалы. На сегодняшний день существует несколько гипотез относительно возможного местоположения буддийского «парадиза» на картах древнего мира.
Например, отдельные исследователи связывают Шамбалу с процветавшими в VII-X веках нашей эры буддийскими городами-государствами Таримского бассейна в Восточном (Китайском) Туркестане, где некогда пролегал Великий шелковый путь.
Другой регион поисков — обширная территория между Ираном и западной Индией. Согласно гипотезе российского тибетолога Б.И. Кузнецова, Шамбала — это древний Иран эпохи Ахеменидов (VI-IV в, до н. э.).

К такому неожиданному выводу ученый пришел в результате расшифровки древней географической карты из тибетско-шаншунского словаря 1842 года. Термин Шамбала, как утверждает Кузнецов, использовался индийцами для названия Ирана и может быть переведен как «держатели мира (блага)».
Из Ирана же индийцы заимствовали и учение о Бесконечном Времени (Зерван Акарана), которое затем было положено в основу буддийской системы Калачакра. Предполагается, что такое учение было создано западными иранскими магами под влиянием древней вавилонской традиции, согласно которой история делится на большие временные циклы и внутри каждого из них все события периодически повторяются.
Современный английский путешественник-исследователь Чарльз Аллен помещает Шамбалу в западном уголке Тибета, вблизи священной горы Кайлас — там, где возникла первая тибетская цивилизация и вместе с ней загадочная религия левосторонней свастики «бон».

Именно в этих местах сложилась бонская легенда о райской земле Олмо-лунрин, которую индийцы позднее окрестили Шамбалой.
Что касается учения о Калачакре, то оно, как полагает Аллен, происходит из древней Гандхары (территория, охватывающая северный Пакистан и восточный Афганистан).
Одна из областей Гандхары — Уддияна, которую обычно отождествляют с живописной долиной Сват, расположенной среди южных отрогов Гиндукуша на севере Пакистана, считается колыбелью тантрического буддизма.
Посетивший эту долину в 629 году китайский паломник Сюань Цзан с удивлением обнаружил там остатки почти полутора тысяч (!) различных буддийских памятников (монастыри, ступы) и поселений, что свидетельствовало о сказочном расцвете буддизма в Уддияне в предшествующую эпоху (II-V века).

После завоевания Гандхары белыми гуннами Калачакра-тантра переместилась в регион западных Гималаев. Версия английского ученого, умело увязывающего древние буддийские и бонские предания с реальными историческими фактами и рисующего весьма достоверную картину «странствий» Кала-чакра-тантры по странам Центральной Азии и ее постепенной трансформации, весьма интересна, при этом стоит обратить внимание на тот факт, что Аллен локализует Шамбалу именно там, куда ее обычно помещают различные эзотерики, — в западной части Тибета.

Что касается самих тибетских лам, то они придерживаются самых разных точек зрения: одни считают, что Шамбала находится (поныне!) в Тибете или же в горной системе Куньлуня, возвышающейся над Тибетским плато, другие — в соседнем Синьцзяне (Западном Китае), однако большинство из них верит, что Шамбала расположена в гораздо более северных широтах — в Сибири или в каком-то другом месте России или даже в Арктике (?!).

Однако большинство нынешних исследователей предпочитают утверждать, что Шамбала не имеет отношения к истории или географии. Шамбала — это вера в лучшее будущее. И как символ этой веры может быть использована для борьбы с настоящим.
Согласно древней тибетской карте в словаре «Tibetan — Zang Zung Dictionary. Delhi, Tibetan Bon Foundation», которую смогли интерпретировать советский тибетолог Б. И. Кузнецов и востоковед Л. Н. Гумилёв , такая страна существовала. Карта восходит к ирано-тибетской картографической традиции.

Согласно этой интерпретации, автор был современником Селевкидов и отразил на карте эпоху господства Сирии, руководимой македонскими завоевателями. Сирия по-персидски называется Шам, а слово «боло» означает «верх», «поверхность». Следовательно, Шамбала переводится как «господство Сирии», что и соответствовало действительности в период III—II в. до н. э.
В теософской традиции Шамбала — место нахождения Великих Учителей, продвигающих эволюцию человечества. Находится в высших вибрациях, и поэтому невидима и недоступна для непросветленного человека.

Подробно описана в работах Николая и Елены Рерих — «Учение Живая Этика (Агни-Йога)».
По одной из легенд 144 тысячи лет господствовала на Земле в незапамятные времена Великая Всемирная Федерация народов. Благодаря накопленным в ней знаниям царил на планете нашей Золотой век. Но, овладев универсальными знаниями, научившись творить чудеса, люди стали считать се6я выше Бога. Они создали идолов-великанов и заставили их служить себе, а потом разрешили идолам брать в жены дочерей своих.

«И увидел Господь, что велико развращение человеков на Земле, и что все мысли и помышления сердца их были зло во всякое время. И раскаялся Господь что создал человека на Земле, и воскорбел в сердце своем» (Книга Бытия, гл. б, стих 5, 6).
И сделал так, чтобы темные быстрые воды очистили Землю от скверны и гордыни человеческой. Единственным местом, которое не затронул всемирный потоп, стал небольшой участок горных вершин.

А девять тысяч лет назад те, кто уцелел, попытались возродить Федерацию. Так появилась в глубине Азии, на границе Афганистана, Тибета и Индии страна чародеев Шамбала, страна махатм («великая душа»). Восемь снежных вершин, как лепестки лотоса, окружают ее.

Великие вожди чародеев скрыли страну от всевидящего ока Господа кольцом густых туманов, а новым землянам, населившим планету, передали: «Географ пусть успокоится — мы занимаем на Земле свое место. Можно обыскать все ущелья, но непрошеный гость путь не найдет».
Много раз, но безуспешно, пытались люди отыскать таинственную страну, завладеть секретными знаниями. Правительства многих стран — Англии, Франции, Германии, Китая — снаряжали экспедиции в глубь Азии. Но ближе всех подобрался к Шамбале разведчик Советской России.

Поздним ноябрьским вечером 1924 года в квартиру сотрудника Института мозга и высшей нервной деятельности Александра Барченко вошли четверо в черном. Один из посетителей, представившись Константином Владимировым (рабочий псевдоним Якова Блюмкина), сообщил хозяину, что его опыты по телепатии заинтересовали органы ОГПУ, и, многозначительно улыбаясь, попросил написать отчет о своей работе на имя Дзержинского.
Опешивший Барченко пытался что-то возразить, но мягкий, льстивый голос улыбающегося человека заставил его не только согласиться с предложением, но еще и с гордостью рассказать о своих новых опытах. Особое впечатление на мужчин в черном произвели фиксация мысли на расстоянии и летающий стол — тот самый стол, за которым сидели посетители, оторвался от пола и повис в воздухе!

Отчет об опытах Барченко Дзержинскому передал лично в руки Яков Блюмкин. Высокий начальник, заинтригованный устным рассказом очевидца, передал отчет сотруднику секретного отдела Якову Агранову. Тот приступил к рассмотрению документа немедленно.
А спустя несколько дней Агранов и Барченко встретились. Ученый рассказал чекисту не только о своих опытах, но еще и об уникальных знаниях страны Шамбала.

В протоколе допроса А. В. Барченко от 23 декабря 1937 года запечатлен этот исторический момент: «В беседе с Аграновым я подробно изложил ему теорию о существовании замкнутого научного коллектива в Центральной Азии и проект установления контактов с обладателями его тайн.
Агранов отнесся к моим сообщениям положительно».
Мало того, Агранов был потрясен…

А внимательно следящий за событиями Блюмкин тем временем вынашивал далеко идущие планы. Дело в том, что Яков Григорьевич хотел сам стать первым обладателем этих тайных знаний и для этого он разработал план действий.
Кстати, что касается личности Блюмкина: в 1921 году Яков перекрыл канал утечки драгоценностей из Гохрана через Эстонию на Запад. Ревельский эпизод едва ли не полностью лег в основу романа Юлиана Семёнова «Бриллианты для диктатуры пролетариата».

Если учесть, что Блюмкин имел агентурные псевдонимы Исаев и Владимиров, а год его рождения и знак зодиака совпадали с соответствующими данными главного героя шпионской эпопеи Семёнова, то не остается сомнений, что Блюмкин послужил в качестве одного из главных прототипов легендарного советского разведчика Штирлица.3
Как показывает дальнейшая история, события развивались по сценарию Якова. Для начала Блюмкину показалось мало, что о Шамбале знают только Дзержинский и Агранов и он убеждает Барченко написать письмо в коллегию ОГПУ.
Потом организовывает встречу Барченко со всем руководством ОГПУ, включая начальников отделов, где ученый излагает свой проект.

Неплохо разбираясь в практической психологии, Яков просит доклад Барченко внести на повестку дня собрания коллегии последним пунктом — уставшие от бесконечных заседаний люди будут готовы положительно решить любое предложение.

В результате при поддержке Бокия и Агранова нам удалось добиться в общем-то благоприятного решения о том, чтобы поручить Бокию ознакомиться детально с содержанием моего проекта, и если из него действительно можно извлечь какую-либо пользу, сделать это».

Так с легкой руки Блюмкина начала действовать секретная лаборатория нейроэнергетики.
Нейроэнергетическая лаборатория разместилась в здании Московского энергетического института и занималась она всем: от изучения НЛО, гипноза и «снежного человека» до изобретений, связанных с радиошпионажем. Для начала перед лабораторией ставилась определенная цель — научиться телепатически читать мысли противника на расстоянии, уметь снимать информацию с мозга посредством взгляда.
Существование нейроэнергетической лаборатории было одним из главных государственных секретов Советской России. Финансировал ее Спецотдел ОГПУ — до мая 1937 года.

В самом конце 1924 года на конспиративной квартире Глеба Бокия, начальника Спецотдела ГПУ, в строжайшем секрете собрались члены тайного общества «Единое трудовое братство».
Надо отметить, что Глеб Бокий был хорошо знаком с Барченко. Еще в 1909 году Александр Барченко, биолог и автор мистических романов, рекомендовал Бокия членам ордена розенкрейцеров.

«Единое трудовое братство» приступило к подготовке научной экспедиции в Шамбалу. Были тщательно разработаны предложения коллегии ОГПУ и использованы разного рода приемы давления на членов этой коллегии, с тем чтобы добиться положительного решения финансирования экспедиции.

У красивого особняка в Шереметевском переулке остановился брюнет среднего роста. Докурив папиросу, он решительно вошел в подъезд и, мгновение помедлив, нажал на кнопку звонка, рядом с которым красовалась медная пластинка с гравировкой: «Профессор академии РККА А. Е. Снесарев». Профессор этот был самым компетентным русским экспертом по Северо-западному району Британской Индии. Сохранились документы, которые красноречиво свидетельствуют, что он занимался исследованием района и как разведчик.

Его интересовала карта района, где, по приблизительным данным располагалась таинственная Шамбала. Снесарев пригласил гостя в кабинет и, тщательно прикрыв за собой дверь, разложил на массивном столе карту Памира.
«Перед вами белая стена Восточного Гиндукуша. С его снеговых вершин вам придется спуститься в трущобы Северной Индии. Если вы познакомитесь со всеми ужасами этой дороги, вы получите впечатление потрясающее.
Это дикие утесы и скалы, по которым пойдут люди с ношей за спиной. Лошадь по этим путям не пройдет. Я шел когда-то этими тропами. Переводчик моего друга из свежего и бодрого человека стал стариком. Люди седеют от тревог, начинают бояться пространства.

В одном месте мне пришлось отстать, и когда я вновь догнал спутников, то застал двух переводчиков плачущими. Они говорили: «Туда страшно идти, мы там умрем»» (Б. Лапин «Повесть о стране Памир»).
Секретная экспедиция переодетых и загримированных под паломников чекистов и ученых должна была выйти из района Рушан на советском Памире. Через горные кряжи афганского Гиндукуша предполагалось пробраться в один из каньонов Гималаев — достичь таинственной Шамбалы.

Стало известно, что спецслужбы Англии, Франции и Китая вели наружное наблюдение за Яковом, без которого экспедиция многое теряла. В разведсводки тщательно заносились все его перемещения: так велико было желание разведок перевербовать советского суперагента. Наш герой при содействии ОГПУ придумал оригинальный ход.
Под него был загримирован чекист, который стал курсировать по обычному маршруту Якова Григорьевича — от дома в Денежном переулке до Наркомата торговли. По данным ОГПУ, подмену не заметили…
Как и предполагалось, руководителем экспедиции был назначен Барченко. А комиссаром — полиглот и мастер восточного рукопашного боя Яков Блюмкин. Помимо основных исследований, ЦК поручал Блюмкину провести ряд операций разведывательного характера.

Яков Григорьевич знал: все идет по его плану, в Шамбалу попадет он один, без всяких провожатых и посторонних глаз. Связавшись с начальником иностранной разведки М. Трилиссером, он убеждает того препятствовать экспедиции: так как добро на проведение исследовательских работ дало ЦК, то и все сведения о «таинственных знаниях Шамбалы» минуют отдел иностранной разведки. Трилиссер задумался…

Приготовления к экспедиции были завершены. Оставалось только провести ряд документов по бюрократическим учреждениям.
31 июля 1925 года Бокий и Барченко посетили приемную Чичерина. Рассказали о проекте и попросили ускорить процедуру выдачи виз. Чичерин дал положительное заключение, но в самый последний момент поинтересовался, знает ли об этом проекте начальник иностранной разведки Трилиссер.
Глеб Иванович Бокий ответил, что проект прошел одобрение в коллегии ОГПУ и в ЦК. Ответ почему-то насторожил Чичерина. Сразу после ухода гостей нарком связался по телефону с Трилиссером. Начальник иностранной разведки ждал этого звонка.
Он истерично кричал в телефонную трубку: «Что себе позволяет этот негодяй Бокий?!» — и требовал отозвать заключение. Чичерин заколебался. Тогда Блюмкин и Трилиссер подключили Генриха Ягоду. И 1 августа Чичерин дал отрицательный отзыв. Экспедиция была отменена.

Бокий в долгу не остался. Секретной лаборатории, которая начала заниматься созданием технических приспособлений — локаторов, пеленгаторов и передвижными отслеживающими
станциями, — удалось поймать сообщение, отправленное неизвестным шифром. В считанные секунды шифр был разгадан: «Пришлите, пожалуйста, ящик водки».
Отправитель — Генрих Ягода, который развлекался на теплоходе с женой сына Алексея Максимовича. Бокий, утаив фамилию отправителя, срочно передал информацию в Особый отдел, начальником которого являлся сам Ягода. Лубянка направила пеленгатор и машину с группой захвата. Дело едва не закончилось перестрелкой между сотрудниками Особого отдела.
В ОГПУ началась война группировок. Экспедицию хотела возглавить каждая из них. Стал собираться компромат, известный у чекистов как «Черная книга Бокия». В войну втянули Дзержинского.

«Железный Феликс» собственноручно возглавил борьбу с заговором зампредов. Но довести дело до победы не смог: в июле 1926 года, после пленума ЦК, он скончался от инфаркта.
Отдел иностранной разведки в строжайшей тайне поручил Блюмкину отыскать Шамбалу и установить с ней контакт. О кознях Блюмкина никто ведь не подозревал. И «Единое трудовое братство» было уверено, что Яков играет на их стороне, поэтому когда Блюмкин сообщил Бокию, что отправляется в Шамбалу один, тот передал ему все карты и секретную информацию.
Так Яков Григорьевич получил одно и то же задание от двух враждующих группировок…

В начале сентября на границе Британской Индии объявился хромой дервиш. Он шел с караваном мусульман из секты исмаилитов к месту паломничества. Но полиция города Балтит решила задержать дервиша: нищий посетил местное почтовое отделение.
Задержанный был отправлен британским конвоем в военную разведку. Дервиша ожидал допрос и расстрел, но англичане не знали, с кем имеют дело: хромой исмаилит бежал, прихватив с собой важнейшую диппочту, адресованную полковнику Стюарту, и английское обмундирование.
Его преследовал целый взвод солдат. И среди них наш Блюмкин в форме колониальных войск — преследовал сам себя. Как только стемнело, в расположении английских колониальных войск на одного солдата стало меньше. Зато на одного монгольского монаха больше…

17 сентября 1925 года монгольский лама присоединился к экспедиции Николая Константиновича Рериха, которая двигалась в район предполагаемого нахождения Шамбалы. Вот запись из дневника художника: «Приходит монгольский лама и с ним новая волна вестей. В Лхасе ждут наш приезд. В монастырях толкуют о пророчествах.
Отличный лама, уже побывал от Урги до Цейлона. Как глубоко проникающая эта организация лам! Толкуем с ламой про бывший случай около Дарджилинга».

По ночам загадочный монах исчезал. Мог не появляться. в расположении экспедиции по нескольку дней, но всегда нагонял путешественников.

Таинственные исчезновения ламы можно объяснить его «мирской работой». Лама Блюмкин наносил на карты блокпосты, пограничные заграждения, высоты, состояние коммуникаций и метраж участков дорог. Не забывал Яков и о Шамбале, пробираясь к ней все ближе и ближе.

Любопытно, что Рерих, узнав, что лама разбирается в тонкостях политической обстановки в России, просил у него совета. Рерих мечтал вернуться на Родину, но боялся преследования органов, и позже, по совету Блюмкина, художник оформит официальные документы как специальный представитель чародеев — махатм, которые якобы всецело одобряют действия большевиков и дают согласие на передачу таинственных знаний советскому правительству.
Так Блюмкин поможет Рериху вернуться в Москву.

Вместе с экспедицией Блюмкин прошел весь Западный Китай. Они посетили более ста тибетских святилищ и монастырей, собрали огромное количество древних сказаний и легенд, преодолели тридцать пять горных перевалов, величайший из которых, Дангла, считался неприступным, собрали бесценную коллекцию минералов и лекарственных трав. Для их изучения в 1927 году был создан специальный институт.
Но достичь таинственной страны Шамбала Якову не удалось. То ли ее не существует вовсе, то ли на картах была нанесена неполная информация, то ли испугался, как многие его предшественники. По крайней мере, нет никаких документов и свидетельств о пребывании Якова Григорьевича в Шамбале.

С 1937 по 1941 год были арестованы и расстреляны все члены тайного общества «Единое трудовое братство». Погиб Глеб Бокий. Его вызвал нарком внутренних дел Николай Ежов и потребовал компромат на некоторых членов ЦК и высокопоставленных чиновников. Бокий отказался. Тогда Ежов зашел с козыря: «Это приказ товарища Сталина».
Бокий пожал плечами: «А что мне Сталин?! Меня Ленин на это место поставил».
В свой кабинет Глеб Бокий не вернулся…

Затем расстреляли члена ЦК Москвина и замнаркома иностранных дел Стомонякова. Дошла очередь и до Барченко. Погибли все, кто был хоть как-то связан с таинственной страной Шамбала.
Но все же первым расстреляли Якова Григорьевича Блюмкина…
А Советская Россия еще раз — в середине пятидесятых годов ХХ века — направляла экспедицию ученых и чекистов в Шамбалу. Они шли маршрутом Блюмкина, поражаясь точным топографическим данным, оставленным «монгольским ламой». Достигли ли Шамбалы — неизвестно…

У русских староверов существует понятие «Беловодье», которое всеми признаками напоминает теософскую Шамбалу. В конце XIX века исследователи Центральной Азии столкнулись с еще одной удивительной легендой — о Беловодском царстве, или Беловодье, стране справедливости и истинного благочестия.

Находясь в 1877 году на берегах «блуждающего» озера Лоб-нор, севернее реки Тарим в Западном Китае (Синьцзянь), знаменитый русский путешественник Николай Пржевальский записал рассказ местных жителей том, как в эти места в конце 1850-х годов пришла партия алтайских староверов числом более сотни человек. Староверы разыскивали Беловодскую «землю обетованную».
Большая часть пришельцев, не удовлетворившись условиями жизни на новом месте, двинулась затем дальше на юг, за хребет Алтынтаг, где и устроила свое поселение. Но и те, и другие в конце концов вернулись на родину, на Алтай.

Рассказ об этом хождении искателей Беловодья, записанный со слов одного из его участников Зырянова, вместе с приложенной к нему маршрутной картой всего путешествия, был впоследствии опубликован в «Записках Русского географического общества».
Беловодье — еще одна загадка центральноазиатской истории. Современные исследователи считают, что это «не определенное географическое название, а поэтический образ вольной земли, образное воплощение мечты о ней».

Поэтому не случайно эту «счастливую крестьянскую страну» русские староверы искали на огромном пространстве — от Алтая до Японии и Тихоокеанских островов и от Монголии до Индии и Афганистана.
Во второй половине XVIII века название Беловодье носили два поселения в Бухтарминской и Уймонской долинах юго-восточного Алтая. Сюда не доходила власть «начальства» и попов — гонителей староверов, не принявших церковной реформы патриарха Никона.
Эта «нейтральная земля» между Российской и Китайской империями была включена в 1791 году в состав России. Именно тогда, как утверждает Чистов, и возникла легенда о Беловодье. Ее появление тесным образом связано с деятельностью секты «бегунов», которая является непримиримым ответвлением старообрядчества.

Первые сведения о поисках староверами заповедной страны относятся к 1825-1826 годам, а во второй половине XIX столетия (1850-1880 гг.) хождения в Беловодье приобретают массовый характер.
Для нас, однако, наибольший интерес представляют сообщения о центральноазиатских маршрутах искателей Беловодья (Монголия — Западный Китай — Тибет). Сходство между христианским и буддийским преданиями впоследствии послужило поводом некоторым авторам говорить об их едином «корне».

Крайне любопытен также другой факт — побывавшие в Индии и Тибете искатели Беловодья принесли оттуда в Россию какие-то элементы восточных учений, которые впоследствии были усвоены и переработаны некоторыми русскими мистическими сектами старообрядческого толка.

via

Последствия для стратегий профилактики вакцинации

J Med Virol. Авторская рукопись; Доступен в PMC 2018 Jul 1.

Опубликовано в Final Edited Форма AS:

PMCID: PMC5805860

NIHMSID: NIHMS844588

ASAD ALI

1 Департамент педиатрии и здоровья детей, Университет Ага-Хан Университет Дорога Карачи

Mohammad Tahir Yousafzai

1 Факультет педиатрии и детского здоровья, Университет Ага Хана 0, стадион, дорога Карачи

Раббиа Варис

1 Департамент педиатрии и детского здоровья, Университет Ага Хана, стадион, дорога Карачи 9

1 Кафедра педиатрии и детского здоровья, Университет Ага Хана, стадион, ул. Карачи

Фатима Азиз

1 Кафедра педиатрии и детского здоровья, Университет Ага Хана, стадион, ул. Карачи

Имран Наим Аббаси, ул. Педиатрии и детского здоровья, улица стадиона Университета Ага Хана Карач привет

Анита Заиди

1 Кафедра педиатрии и детского здоровья, Университет Ага Хана стадион дорога Карачи

1 Кафедра педиатрии и детского здоровья, Университет Ага Хана стадион дорога Карачи

* 16 Корр. Али, доцент, кафедра педиатрии и детского здоровья, Университет Ага Хана, стадион Роад Карачи, удэ[email protected] (опубликовать электронное письмо), тел.: +92-21-3486-5010. Окончательная отредактированная версия этой статьи доступна по адресу J Med Virol. См. другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

Значительный прогресс достигнут в разработке вакцин против респираторно-синцитиального вируса (RSV), при этом несколько вакцин-кандидатов в настоящее время находятся на клинической стадии разработки. Обоснование инвестиционного обоснования финансирования вакцины против RSV государственным сектором потребует оценки бремени, экономической эффективности и воздействия.Целью данного исследования является определение доли, возрастного распределения и клинического спектра госпитализаций, связанных с РСВ, у детей в Карачи, Пакистан. Трехлетнее проспективное исследование проводилось в больнице Университета Ага Хана в Карачи, городе с населением 20 миллионов человек на юге Пакистана, с августа 2009 г. по июнь 2012 г. В него были включены дети в возрасте до пяти лет, госпитализированные с острыми респираторными инфекциями (ОРЗ). Собирали мазки из горла и тестировали на РСВ с помощью ПЦР в реальном времени. Многопараметрический лог-биномиальный регрессионный анализ был проведен для выявления факторов, связанных с инфекцией РСВ.Из 1150 обследованных детей РСВ выявлен у 223 (19%). Самая высокая частота выявления РСВ была у детей раннего возраста в возрасте до 3 месяцев (48/168, 29%), на долю которых приходилось 22% всех выявленных РСВ. Наиболее частым диагнозом у новорожденных с положительным результатом на РСВ (в возрасте до 12 месяцев) был бронхиолит, за которым следовала пневмония, в то время как у детей старшего возраста в возрасте от одного до пяти лет наиболее частыми диагнозами были пневмония и астма. Несмотря на то, что RSV выявляется круглый год, наиболее распространен он с августа по октябрь с пиком в сентябре, что совпадает с сезоном дождей.Это исследование показало, что РСВ независимо связан с более молодым возрастом (p=0,036), сезоном дождей (p<0,001), посткашлевой рвотой (p=0,008), интубацией (p=0,003) и диагнозом бронхиолита при выписке (p=0,004). ). Вакцины против RSV, предназначенные для этой возрастной группы, вероятно, принесут замечательную пользу.

Ключевые слова: Респираторно-синцитиальный вирус, РСВ, пневмония, ОРЗ, бронхиолит, астма, Карачи, лог-биномиальная регрессия, Пакистан

ВВЕДЕНИЕ

РСВ является наиболее важной вирусной причиной тяжелых ОРЗ у детей во всем мире [Nair et al., 2010]. ОРИ являются причиной примерно двух миллионов смертей детей в год во всем мире, 70% из которых приходится на Африку и Южную Азию [Bryce et al., 2005; Уильямс и др., 2002]. По оценкам, смертность, связанная с РСВ, составляет 66 000–199 000 детей в возрасте до 5 лет, а 15–40% педиатрических госпитализаций с ОРИ в развивающихся странах связаны с РСВ. Это делает РСВ одной из ведущих мишеней вмешательств общественного здравоохранения [Breiman et al., 2013; Холл и др., 2009; Наир и др., 2010].

Область вакцин против РСВ развивается беспрецедентными темпами. В то время как более 50 вакцин-кандидатов RSV в настоящее время находятся в разработке, около десяти кандидатов либо проходят, либо уже проходят клинические испытания [Modjarrad et al. , 2015]. Живые ослабленные подходы разрабатывались десятилетиями и до недавнего времени были единственными кандидатами на клиническое тестирование. Совсем недавно были достигнуты значительные успехи в разработке вакцин против RSV с использованием других технологий. В то время как большинство из них все еще находятся на доклинической стадии, четыре из этих новых кандидатов уже вступили в клиническую разработку — Novavax (Ph3), GSK (Ph2) и MedImmune (Ph2), тестирующие кандидатов на основе белка F RSV и GSK (Ph2, 2013 г.). приобретение Okairos) тестирование кандидата аденовируса/MVA прайм/бустер, экспрессирующего RSV F, и слитого белка N и M2-1 [PD-VAC, 2014].Предварительные результаты фазы 2 вакцины с наночастицами RSV F, произведенной Novavax, показывают, что иммунизация матерей этой вакциной безопасна для плода и может защитить младенцев от RSV [NOVAVAX, 2015].

Чтобы обосновать необходимость внедрения вакцины в условиях ограниченных ресурсов и определить оптимальную стратегию доставки вакцины, важно понимать риски заболеваемости и смертности от госпитализаций, связанных с РСВ, в различных возрастных группах, особенно в условиях с самым высоким бременем болезни. С этой целью мы провели трехлетнее проспективное наблюдательное исследование, чтобы определить частоту, клинические особенности и тяжесть РСВ у детей разных возрастных групп, госпитализированных с ОРИ в больницу третичного уровня в Карачи, Пакистан.

МЕТОДЫ

Исследование проводилось с августа 2009 г. по июль 2012 г. в больнице Университета Ага Хана в Карачи, Пакистан. Пакистан с населением около 185 млн человек [WorldBank, 2015] является одной из крупнейших стран Южной Азии, на долю которой вместе с Африкой приходится 70 % связанной с ОРИ детской смертности во всем мире [Bryce et al., 2005]. Карачи — крупный космополитический город Пакистана, расположенный на побережье Аравийского моря, с населением 20 миллионов человек. В Карачи относительно мягкий климат с двумя основными сезонами: летом и зимой, а с июля по сентябрь идут муссонные дожди. Университетская больница Ага Хана — это некоммерческая частная больница третичного уровня. В нем есть общее педиатрическое отделение на 84 койки и современное педиатрическое отделение интенсивной терапии (ОИТ). Он обслуживает в основном население Карачи, но также получает рекомендации из остальной части провинции Синд.Около трех четвертей больных относятся к низшей и средней социально-экономической группе. Финансовая помощь доступна для тех, кто не может позволить себе услуги, и около 25% стационарных пациентов получают такую ​​помощь.

Критерии включения в данное исследование включали возраст менее 5 лет и госпитализацию в течение 48 часов до включения с одним или несколькими из следующих диагнозов при поступлении, перечисленных лечащей медицинской бригадой: ОРЗ, апноэ, обострение астмы. , бронхиолит, круп, обострение муковисцидоза, лихорадка новорожденного, фебрильные судороги, респираторный дистресс, средний отит, фарингит, пневмония, синусит и инфекция верхних дыхательных путей (ОРИ).Диагнозы при поступлении, поставленные основной командой, были приняты как таковые и не были проверены или переклассифицированы врачами-исследователями. Новорожденные, которые никогда не покидали больницу, были исключены. Исследование было одобрено Комитетом по этической экспертизе Университета Ага Хана. После получения письменного информированного согласия родителей/опекунов фиксировалась демографическая и клиническая информация о текущем заболевании. Мазок из зева был получен с использованием коммерческих флокированных тампонов (Diagnostics Hybrid Inc.) и немедленно доставлен в исследовательскую лабораторию в Universal Transport Media (Diagnostics Hybrid Inc.) для тестирования RSV, HMPV и гриппа с использованием моноплексного анализа RT-PCR в реальном времени. РНК экстрагировали с использованием мини-набора QiaAmp Viral RNA (Qiagen) в соответствии с инструкциями производителя. Праймеры и зонды для RSV соответствовали протоколу CDC RT-PCR в реальном времени для RSV [Mentel et al., 2003]. После выписки из больницы были проанализированы медицинские записи всех зарегистрированных участников и записаны данные о стационарном обследовании, ведении и клиническом течении.

СТАТИСТИЧЕСКИЙ АНАЛИЗ

Описательный анализ был проведен для описания возраста детей и доли респираторной вирусной этиологии. Связи между социально-демографическими характеристиками, сезонностью, клиническими проявлениями и РСВ-инфекцией оценивали с помощью одномерного и многомерного лог-биномиального регрессионного анализа. Все переменные, значимые при p<0,30 на одномерном уровне, были протестированы одновременно в многомерной регрессионной модели. Окончательная модель с переменными, значимыми на уровне значимости 5%, была выбрана с использованием метода наилучшего подмножества. Были рассчитаны грубые и скорректированные отношения рисков с 95% доверительными интервалами.Статистический анализ проводили с использованием программного обеспечения Stata (версия 11).

РЕЗУЛЬТАТЫ

Всего за период исследования в AKUH поступило 3830 детей в возрасте до 5 лет с ОРЗ и сопутствующим диагнозом. Из них 30 % страдали пневмонией, 25 % — астмой, 24 % — ОРЗ и 22 % — бронхиолитом. Пик госпитализаций по поводу острых ОРЗ пришелся на февраль, а в июне и июле они были относительно ниже. Это было более очевидно в 2010 и 2012 годах. Случаи астмы не показали какой-либо определенной тенденции.У больных бронхиолитом не было особого пика, но меньше случаев наблюдалось с апреля по июль каждого года. Пневмония, с другой стороны, характеризовалась двумя пиками в год — в феврале и в период с августа по сентябрь.

Ежемесячное количество случаев для каждого диагноза среди общего числа поступивших в Университет Ага Хана в Карачи

Всего в исследование было включено 1150 (33%) из 3830 детей. Доля случаев РСВ в разные месяцы варьировала от 2% до 43%.Случаи начали расти в июле (14%), достигнув пика (43%) в сентябре, а затем медленно снижались, достигнув 8% в декабре. Уровень положительности РСВ самый низкий в период с января по февраль и самый высокий в сентябре-октябре () . показывает процентное распределение случаев ОРИ, связанных с РСВ, с различными диагнозами при выписке в разные месяцы регистрации. Случаи пневмонии показали более высокий уровень положительных результатов на РСВ в период с апреля по июнь, в то время как, с другой стороны, случаи бронхиолита и инфекций верхних дыхательных путей в период с августа по октябрь показали аналогичную тенденцию к увеличению числа случаев, связанных с РСВ.

Процент инфицирования РСВ среди детей в возрасте до 5 лет по месяцам регистрации в период с августа 2009 г. по июль 2012 г. (Гистограмма) зачисление в период с августа 2009 г. по июль 2012 г. (Гистограмма)

Наиболее частым диагнозом при поступлении среди зачисленных была пневмония (38%), за которой следовали бронхиолит (28%), астма (17%) и ОРЗ (13%). РСВ был обнаружен у 223 (19%) детей, включенных в исследование ().В целом, 65% зарегистрированных детей были мальчиками, при этом доля среди детей с отрицательным результатом на RSV была несколько выше (66%), чем с положительным результатом на RSV (62%). Дети с РСВ были относительно моложе (медиана возраста 7 лет, межквартильный интервал 3-13 месяцев), чем дети с отрицательным результатом на RSV (медиана 10 лет, межквартильный интервал 4,9-21 месяц). Около 30% зарегистрированных детей были курильщиками в домашнем хозяйстве с почти одинаковым соотношением между детьми с положительным и отрицательным статусом РСВ. У более чем 85% зарегистрированных детей был кашель, за которым следовала лихорадка (73%), заложенность носа (69%) и одышка (68%). Около 2% детей нуждались в интубации, при этом доля случаев с положительным результатом на РСВ несколько выше, чем с отрицательным результатом (3,6% против 2% соответственно). Кроме того, 41 (3,6%) ребенок нуждался в госпитализации/переводе в отделение реанимации и интенсивной терапии (ОИТ), а 22 ребенка (1,9%) умерли во время госпитализации (2 среди РСВ-позитивных и 20 — среди РСВ-отрицательных).

Таблица 1

Сравнение зарегистрированных RSV-положительных и отрицательных детей в возрасте до 5 лет, поступивших с острым респираторным заболеванием в Университетскую больницу Ага Хана, Карачи, Пакистан (август 2009 г. – июль 2012 г.)

) )
Исходные характеристики RSV положительный n=223 (%) RSV отрицательный n=927 (%) Всего N (%)
Возраст в месяцах (медиана, IQR) 7 (3 — 13. 4) 10 (4.9 — 21) 9 (4.1-18.8)
Возрастные группы (месяцы):
0-2 48 ( 21,5 ) 120 ( 12.9 ) 168 ( 14,6 )
3-5 47 ( 21.1 ) 157 ( 16,9 ) 204 ( 17,7 )
6-11 53 ( 23,8 ) 242 ( 26. 1 ) 295 ( 25,7 )
12-60 75 ( 33,6 ) 408 ( 44,0 ) 483 ( 42,0 )
Мужской 139 ( 62.3 ) 611 ( 65,9 ) 750 ( 65.2 )
Вес при рождении (кг) (Median, IQR) 2,8 (2,5 — 3.2) 2. 9 (2.5 — 3.3 ) 2.9 (2.5-3.3)
месяцы кормления грудью (медианы, IQR) 6 (3 — 12) 6 (2 — 12) 6 (2-12)
Посещение детских садов 11 ( 5.0 ) 50 ( 5.5 ) 61 ( 5.4 )
Курильщики в доме 62 ( 28,1 ) 281 ( 30,7 ) 343 ( 30. 2 )
Количество членов домохозяйства (медиана, IQR) 7 (5 — 10) 7 (5 — 10) 7 (5-10)
Клинические признаки
лихорадка 152 ( 68.2 ) 688 ( 74.2 ) 840 ( 73,0 )
кашель 200 ( 89,7 ) 805 ( 86,8 ) 1005 ( 87,4 )
хрипов / шумное дыхание 120 ( 53,8 ) 454 ( 49,0 ) 574 ( 49. 9 ) 574 ( 49,9 )
Бедный аппетит 137 ( 61,4 ) 559 ( 60125 559 ( 60125 559) .3 ) 696 ( 60.59 )
3012
164 ( 73.5 ) 619 ( 66,8 ) 783 ( 68,1 )
Ухо Hathe 23 ( 10.3 ) 119 ( 12,8 ) 142 ( 12. 3 )
боль в горле 110 ( 49,3 ) 456 ( 49.2 ) 566 ( 49 .2 )
Post-Tussive Emesis 89 ( 39,9 ) 294 ( 31.7 ) 383 ( 33.3 )
Назальные заторы 168 ( 75,3 ) 620 ( 66,9 ) 788 ( 68,5 )
Больничный курс
Интубированный 8 ( 3,6 ) 19 ( 2,0 ) 27 ( 2. 3 )
ICU Прием или передача 9 ( 4.0 ) 32 ( 3,5 ) 41 ( 3.6 )
Умерли во время госпитализации 2 ( 0,9 ) 20 ( 2,2 ) 22 ( 1,9 )

Из 223 детей с положительным результатом на РСВ 148 были в возрасте до 12 месяцев (показатель выявления РСВ 22%), 47 были в возрасте от 12 до 24 месяцев (показатель выявления 18%) и 27 были в возрасте от 24 до 60 месяцев (показатель выявления 12%). скорость обнаружения).В течение первого года самая высокая частота выявления была у младенцев в возрасте до 3 месяцев (29%), за которыми следовали дети в возрасте от 3 до 6 месяцев (23%). Кашель и заложенность носа были преобладающими клиническими признаками, в то время как лихорадка была отмечена родителями в двух третях положительных случаев РСВ во всех возрастных группах. Бронхиолит был ведущим диагнозом при выписке у RSV-положительных детей в возрасте до 12 месяцев, за ним следовала пневмония. Пневмония была наиболее частым диагнозом у RSV-положительных детей в возрасте от 1 года до 5 лет, за ней следовали обострения астмы.Таблица 2 месяцев n = 204 (%) 6-11 месяц n = 295 (%) 12-60 месяцев n = 483 (%) % RSV положительный 48 ( 28,6 ) 47 ( 23,0 ) 53 ( 18,0 ) 75 ( 15. 5 ) Клинические признаки RSV-позитивных пациентов 9012 9 26 ( 54,2 ) 29 ( 61,7 ) 39 ( 73,6 ) 58 ( 77,3 ) Кашель 44 ( 91,7 ) 43 ( 91,5 ) 46 ( 86,8 ) 67 ( 89,0053 ) хрипов / шумное дыхание 28 ( 58,3 ) 23 ( 48. 9 ) 31 ( 58,5 ) 38 ( 50,7 ) Бедный аппетит 31 ( 64.6 ) 30 ( 63,8 ) 42 ( 79.2 ) 34 ( 45.3 ) одышка 35 ( 72,9 ) 37 ( 78.7 ) 40 ( 75.5 ) 52 ( 69. 3 ) ) EAR ACHE 3 ( 6.3 ) 8 ( 17,0 ) 7 ( 13.2 ) 5 ( 6,7 ) боль в горле 22 ( 45.8 ) 23 ( 48.9 ) 32 ( 60,4 ) 33 ( 44,0 ) -кашлевая рвота 17 ( 35. 4 ) 17 ( 36.2 ) 20 ( 37.7 ) 35 ( 46,7 ) ) Назальные заторы 40 ( 83,3 ) 32 ( 68,1 ) 42 ( 79,2 ) 54 ( 72,0 ) Диагноз при выписке пациентов с положительным результатом на РСВ * Пневмония 17 ( 35. 4 ) 17 ( 36.2 ) 20 ( 37,7 ) 33 ( 44,0 ) Бронхиолит 26 ( 54.2 ) 25 ( 53.2 ) 23 ( 43.4 ) 15 ( 20,5 ) астма 4 ( 8.3 ) 4 ( 8.5 ) 7 ( 13.2 ) 16 ( 21,3 ) Инфекции верхних дыхательных путей 3 ( 6. 3 ) 0 8 ( 15.1 ) 9 ( 12,0 ) Другие 4 ( 8,3 ) 6 ( 12.8 ) 3 ( 5.7 ) 7 ( 9.3 ) Госпитальный курс RSV-позитивных пациентов Продолжительность пребывания (дней), средняя (SD) 2,7 (2,6) 3. 2 (2.6) 3.6 (2.8) 3.5 (4.4) Профилированные 2 ( 4.2 ) 1 ( 2.1 ) 1 ( 1.9 ) 4 ( 5.3 ) ICU Прием или передача 2 ( 4,2 ) 1 ( 2.1 ) 2 ( 3.8 ) 4 ( 5. 3 ) Смерть во время госпитализации 0 0 0 2 ( 2.7 )

Многофакторный регрессионный анализ показал, что риск РСВ линейно снижается с увеличением возраста (скорректированный ОР 1,81; 95% ДИ 1,17–2,81 среди детей в возрасте до 3 месяцев, ОР 1,51; 95% ДИ 0,99–2,32). среди детей в возрасте 3–5 месяцев и ОР 1,15; 95% ДИ 0,77–1,72 среди детей в возрасте 6–12 месяцев, учитывая детей в возрасте ≥12 месяцев в качестве эталонной категории). Кроме того, риск РСВ наиболее высок в период с июля по сентябрь (скорректированный ОР 3,56; 95% ДИ 2,33–5,43), за которым следует октябрь-декабрь (скорректированный ОР 2,89; 95% ДИ 1.88-4,44) по сравнению с первым кварталом года. Мы также обнаружили, что RSV-положительные дети почти в четыре раза чаще были интубированы по сравнению с RSV-отрицательными детьми (скорректированный ОР 3,97; 95% ДИ 1,59–9,91). Рвота после кашля и диагноз бронхиолита также были в значительной степени связаны с инфекцией РСВ (скорректированный ОР 1,54; 95% ДИ 1,12–2,11 и ОР 1,63; 95% ДИ 1,16–2,27 соответственно). Таблица 3 Грубый RR (95% CI) P CI) P Значение для сырой RR ADJ RR (95% CI) P для ADD RR



Возраст в месяцах 0. 97 (0,96-0,99) <0,001 — — —
Возрастные группы (месяцы) 0-2 1.84 (1.28-2. 64) 1.81 (1.17 -2,81) 3-5 1,48 (1,03-2,14) 0,006 1,51 (0,99-2,32) 0,036 6-11 1.16 (0.81-1.65) (0,77-1,72) 12-60 1 9 9

Мужской 0. 88 (0,67 -1.16) 0.366 — — 9019
Вес рождения (кг) 0.89 (0.73-1.09) 0.264 — —
Родился рано 0.99 (0.72-1.35) 0.952 — — 9019
Период регистрации (сезонность): Jan — 1 1 апрель-июнь 1,04 (0,59-1,82) <0,001 1,03 (0,56-1,89) <0,001 июль-сен 2. 77 (1.90-4.03) 3.56 (2.33-5.43) Окт-декабрь 2,29 (1.56-3.38) 2,89 (1.88-4.44)
Продолжительность кормления грудью (месяцы) 0,99 (0,96-1.02) 0.566 — — —

Дневной уход 1. 09 (0.59-2.00) 0,777 — —
Курильщики в доме 1.10 (0.83-1.49) 0.489 — — 9019
Количество членов домохозяйства 1.01 (0,98-1.03) 0. 647 — —

Индекс скученности (члены домохозяйства/число спален) 0,94 (0,84-1,06) 0,312 — — 80
Клинические признаки
лихорадка 0.79 (0.60-1.05) 0.101 — — 9019
кашель 1. 26 (0.81-1.93) 0.303 — —
хрипов / шумное дыхание 1.02 (0,99-1.05) 0.245 — — —
Бедный аппетит 0,98 (0,86-12) 0. 780 — —
одышка 1.14 (0,98-1,33) 0,081 — — — 0,93 (0.81-1.08) 0.357 — —
Боли в горле 1. 01 (0,94 -1.07) 0,974 — — —
Post-Tussive Emesis 1.05 (1.01-1.09) 0.037 1,54 (1,12-2,11) 0,008
заложенность носа 1,05 (1,12)5 0,029 — —
Больничный курс
Интубированный 1,55 (0,76-3,13) 0,225 3,97 (1,59-9,91) 0,003
Поступление или перевод в ОИТ 1. 14 (0.58-2.22) 0,705 — — 9012
длина пребывания в больнице (дней) 1.01 (0,9-1.04) 0.667 — —
Умершие при госпитализации 0,46 (0,12-1,87) 0,280 —

5 — 4


Диагностика при выписке
URI 0. 67 (0.42-1.06) 0.09 — — 9019
астма 0,78 (0.53-1.14) 0.20 — — Pneumonia 1. 06 (0.81-1.38) 0.69 — — —

Бронхиолит 1.70 (1.30-2.22) <0,001 1.63 (1.16-2.27) 0,004

ОБСУЖДЕНИЕ

Наше исследование показало, что RSV циркулирует в течение всего года в Карачи, Пакистан, но пик сезона приходится на период муссонных дождей с июля по сентябрь каждого года. Эти результаты согласуются с исследованиями, проведенными в прибрежных районах Индии, Таиланда, а также Малайзии, где сезон дождей протекает по аналогичной схеме [John et al., 1991; Хор и др., 2012; Наорат и др., 2013]. Наши результаты также согласуются с предыдущим исследованием, проведенным в крупной государственной больнице третичного уровня в Карачи, Пакистан [Ali et al., 2013]. С другой стороны, исследование, проведенное в Исламабаде и Равалпинди, Пакистан, показало, что РСВ часто выявляли с декабря по февраль [Tariq et al., 2005]. Вероятно, это связано с климатическими различиями между разными городами: в Исламабаде и Равалпинди умеренный климат, а в Карачи — более мягкий прибрежный климат. В районах с умеренным и средиземноморским климатом вспышки РСВ происходят в зимние месяцы, в то время как в тропических условиях пик инфекций РСВ обычно приходится на сезонные дожди [Weber et al., 1998].

На долю РСВ приходится почти треть госпитализаций, связанных с ОРИ, у младенцев в возрасте до 3 месяцев в нашем исследовании. Риск РСВ среди детей в возрасте до трех месяцев, госпитализированных с ОРИ, был почти на 80% выше по сравнению с детьми в возрасте старше одного года. Эти результаты согласуются с исследованием, проведенным в США Hall et al , показывающим самый высокий риск РСВ среди детей в возрасте до пяти месяцев [Hall et al., 2009]. Более высокое бремя болезней у детей раннего возраста имеет значение для ожидаемой программы вакцинации.Будущая вакцина против RSV, направленная на защиту младенцев в этой возрастной группе либо путем иммунизации матери, либо путем иммунизации ребенка сразу после рождения, скорее всего, окажет наибольшее влияние на общественное здравоохранение.

Мы обнаружили, что дети с РСВ-инфекцией с большей вероятностью имели послекашлевую рвоту и диагноз бронхиолита по сравнению с детьми, госпитализированными по поводу ОРИ, но с отрицательным результатом теста на РСВ. Интересно, что дети с РСВ-ассоциированным ОРИ почти в 4 раза чаще были интубированы по сравнению с детьми, у которых не было РСВ-ассоциированного ОРИ. В литературе редко сообщается об увеличении тяжести заболевания, связанного с RSV [Weber et al., 1998]. Двое детей, включенных в наше исследование, у которых был связан с РСВ ОРЗ, умерли, но общий уровень смертности не различался у РСВ-положительных и РСВ-отрицательных детей. Из двух детей, перенесших РСВ и умерших при госпитализации, один мальчик 3,5 лет с синдромом Дауна, дефектом межжелудочковой перегородки и легочной гипертензией умер через 7 дней госпитализации в ОРИТ.Помимо RSV, у него также были обнаружены грипп и псевдомонадная бактериемия. Вторым ребенком была девочка в возрасте 2 лет и 4 месяцев, родившаяся после 31 недели беременности, но в остальном ранее здоровая, которая была госпитализирована с пневмонией на 3 дня, включая 1 день в отделении интенсивной терапии, требующий ИВЛ перед ее смертью.

Сильные стороны этого исследования включают ПЦР-тестирование на РСВ, которое является золотым стандартом и часто недоступно за пределами исследовательских учреждений в странах третьего мира. Данные собирались проспективно в течение трех лет, поэтому выводы о сезонности, вероятно, верны.Исследование также имело несколько ограничений. Хотя наше исследование имеет относительно большой размер выборки из 1150 младенцев, значительная часть детей, которые, возможно, соответствовали критериям, не были зачислены. Основные причины незачисления включали неясный диагноз во время госпитализации, отсутствие наблюдения в выходные дни, раннюю выписку до того, как семья могла обратиться для регистрации, задержку более чем на 48 часов с обращением к семье для регистрации (особенно когда пациенты были госпитализированы). в выходные дни), а также неготовность или отказ родителей дать согласие.Тем не менее, как показано на рисунке, схема регистрации соответствовала схеме госпитализации по ОРИ, поэтому сезонность и относительное распределение различных синдромов, вероятно, верны. Исследование проводилось в одной больнице третичного уровня, которая может не отражать весь социально-экономический спектр пакистанского населения и, вероятно, не отражать модели из других городов, расположенных в других широтах. Поскольку большинство детских смертей происходит на дому из-за низкого уровня обращений населения за медицинской помощью в специализированные учреждения, этиологический спектр в исследованиях на уровне местных сообществ может отличаться от того, что было выявлено в этом исследовании на базе больницы.Для более точной оценки бремени РСВ в стране в идеале следует проводить исследования на уровне местных сообществ.

Благодарности

Финансирование

Это исследование было поддержано грантом 1R01TW008126 от FIC/NIH под названием «Бремя гриппа и RSV у детей в Пакистане» (PI Asad Ali). Обучение доктора Али частично поддерживалось грантами Фогарти на обучение D43TW007585 и 2D43TW001035. Данные хранились и управлялись с помощью электронного инструмента сбора данных REDCap, финансируемого за счет гранта NIH UL1 TR000445 от NCATS/NIH.Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Сноски

Конкурирующие интересы

Авторы заявили об отсутствии конкурирующих интересов.

ССЫЛКИ

  • Али С.А., Ховаджа А.Р., Башир М.З., Азиз Ф., Мустафа С., Заиди А. Роль метапневмовируса человека, вируса гриппа А и респираторно-синцитиального вируса в возникновении тяжелой пневмонии, определенной ВОЗ, у детей в развивающихся странах.Плос Один. 2013;8(9):e74756. Дои: 10.1371/journal.pone.0074756. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Breiman RF, Van Beneden CA, Farnon EC. Надзор за респираторными инфекциями в странах с низким и средним уровнем дохода: опыт Международной программы по выявлению новых инфекций Центров по контролю и профилактике заболеваний. J заразить Dis. 2013; 208 (Приложение 3): S167–172. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Bryce J, Boschi-Pinto C, Shibuya K, Black RE.Оценка ВОЗ причин детской смертности. Ланцет. 2005;365(9465):1147–1152. [PubMed] [Google Scholar]
  • Hall CB, Weinberg GA, Iwane MK, Blumkin AK, Edwards KM, Staat MA, Auinger P, Griffin MR, Poehling KA, Erdman D, Grijalva CG, Zhu Y, Szilagyi P. Бремя Респираторно-синцитиальная вирусная инфекция у детей раннего возраста. N Engl J Med. 2009;360(6):588–598. [Статья PMC бесплатно] [PubMed] [Google Scholar]
  • John TJ, Cherian T, Steinhoff MC, Simoes EA, John M. Этиология острых респираторных инфекций у детей в тропической южной Индии.Преподобный Заражает Дис. 1991; 13 (Приложение 6): S463–469. [PubMed] [Google Scholar]
  • Khor CS, Sam IC, Hooi PS, Quek KF, Chan YF. Эпидемиология и сезонность респираторных вирусных инфекций у госпитализированных детей в Куала-Лумпуре, Малайзия: ретроспективное исследование за 27 лет. БМС Педиатр. 2012;12:32. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Mentel R, Wegner U, Bruns R, Gurtler L. ПЦР в реальном времени для улучшения диагностики респираторно-синцитиальной вирусной инфекции. J Med Microbiol. 2003; 52 (часть 10): 893–896.[PubMed] [Google Scholar]
  • Моджаррад К., Гирсинг Б., Каслоу Д.С., Смит П.Г., Мурти В.С. Консультация ВОЗ по докладу о разработке вакцины против респираторно-синцитиального вируса по итогам совещания Всемирной организации здравоохранения, состоявшегося 23–24 марта 2015 г. Вакцина. 2016;34(2):190–197. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Nair H, Nokes DJ, Gessner BD, Dherani M, Madhi SA, Singleton RJ, O’Brien KL, Roca A, Wright PF, Bruce N, Chandran A, Theodoratou Э., Сутанто А., Седьянингсих Э.Р., Нгама М., Мунивоки П.К., Картасасмита С., Симоэс Э.А., Рудан И., Вебер М.В., Кэмпбелл Х.Глобальное бремя острых инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей раннего возраста: систематический обзор и метаанализ. Ланцет. 2010;375(9725):1545–1555. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Наорат С., Читтаганпитч М., Тхамтитиват С., Хенчайчон С., Саватвонг П., Срисэнгчай П., Лу И., Чуананон С., Аморнинтапичет Т., Чантра С., Эрдман Д.Д., Мэлони С.А., Акарасеви П., Баггетт Х.К. Госпитализации по поводу острой инфекции нижних дыхательных путей, вызванной респираторно-синцитиальным вирусом, в Таиланде, 2008–2011 гг.J заразить Dis. 2013; 208 (Приложение 3): S238–245. [PubMed] [Google Scholar]
  • NOVAVAX Novavax объявляет о положительных основных данных фазы 2 клинических испытаний вакцины RSV F для защиты младенцев посредством иммунизации матерей. 2015 г. http://www.prnewswire.com/news-releases/novavax-announces-positive-top-line-data-from-phase-2-clinical-trial-of-rsv-f-vaccine-to-protect-infants -через-материнскую-иммунизацию-300149808.html.
  • PD-VAC W. Состояние исследований в области вакцин и разработка вакцин против РСВ.Всемирная организация здоровья; 2014. [Google Scholar]
  • Тарик В.У., Вакар Т., Али С., Гани Э. Зимний пик распространения респираторно-синцитиального вируса в Исламабаде. Троп Док. 2005;35(1):28–29. [PubMed] [Google Scholar]
  • Weber MW, Mulholland EK, Greenwood BM. Респираторно-синцитиальная вирусная инфекция в тропических и развивающихся странах. Троп Мед Int Health. 1998;3(4):268–280. [PubMed] [Google Scholar]
  • Williams BG, Gouws E, Boschi-Pinto C, Bryce J, Dye C. Оценки мирового распределения детской смертности от острых респираторных инфекций.Ланцет Infect Dis. 2002;2(1):25–32. [PubMed] [Google Scholar]
  • WorldBank . Пакистан: 2015 г. [15 сентября 2015 г.]. из: http://www. worldbank.org/en/country/pakistan. [Google Scholar]

Молекулярная характеристика генотипов циркулирующего респираторно-синцитиального вируса (RSV) в провинции Гилгит-Балтистан в Пакистане в зимний сезон 2011-2012 гг.

Abstract

Респираторно-синцитиальный вирус (RSV) является основной причиной острых инфекций нижних дыхательных путей у детей раннего возраста, но очень мало известно о его эпидемиологии и циркулирующих генотипах в Пакистане.В этом исследовании проанализированы эпидемиологические и молекулярные характеристики генотипов РСВ, обнаруженных у пакистанских детей в возрасте до 2 лет с острыми инфекциями дыхательных путей (ОРЗ) в больнице третичного уровня в провинции Гилгит-Балтистан (Великобритания) в зимний сезон 2011-12 гг. РСВ выявлен у 75 из 105 детей с острой респираторной инфекцией. Младенцы мужского пола в возрасте от 2 до 6 месяцев составляют самый высокий процент положительных случаев РСВ. Было обнаружено, что эпидемиологические факторы, такие как недоношенность, средний вес, клинические признаки и диагноз, при сравнении между положительными и отрицательными группами по РСВ оказались статистически незначимыми. Филогенетический анализ классифицировал все 75 штаммов РСВ на 71 штамм подгруппы А и 4 штамма подгруппы В соответственно. Штаммы, принадлежащие к подгруппам А и В, были далее подразделены на NA1/GA2 и ВА соответственно. Идентичность нуклеотидной и выведенной аминокислотной последовательности была относительно высокой среди этих штаммов (> 90%). Изоляты RSV-A и RSV-B имели два потенциальных сайта N-гликозилирования в HVR2 белка G и с тяжелым O-гликозилированием остатков серина и треонина (оценка G 0.5-0,7). В этом отчете подчеркивается значение РСВ как доминирующего вирусного этиологического агента ОРИ у детей, а также необходимость продолжения молекулярно-эпидемиологических исследований для раннего выявления распространенных штаммов и новых генотипов для понимания эпидемиологии инфекций РСВ в различных регионах Пакистана.

Образец цитирования: Аамир У.Б., Алам М.М., Садия Х., Заиди С.С.З., Кази Б.М. (2013) Молекулярная характеристика генотипов циркулирующего респираторно-синцитиального вируса (РСВ) в провинции Гилгит-Балтистан в Пакистане в зимний сезон 2011-2012 гг. ПЛОС ОДИН 8(9): е74018. https://doi.org/10.1371/journal.pone.0074018

Редактор: Дуншэн Чжоу, Пекинский институт микробиологии и эпидемиологии, Китай

Получено: 2 мая 2013 г.; Принято: 25 июля 2013 г.; Опубликовано: 13 сентября 2013 г.

Авторские права: © 2013 Aamir et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: У авторов нет поддержки или финансирования для отчета.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Респираторно-синцитиальный вирус человека (RSV) относится к роду Pneumovirus семейства Paramyxoviridae , который вызывает ежегодные вспышки во всем мире [1-4]. Инфекции, вызванные RSV, могут приводить к заболеваниям от легкой до тяжелой степени с поражением нижних дыхательных путей, что приводит к бронхиолиту и пневмонии.РСВ представляет собой значительную часть бремени острых респираторных заболеваний, особенно в первый год жизни [5]. Он по-прежнему является ведущей причиной госпитализации детей в возрасте до 5 лет в промышленно развитых странах, а также связанной с пневмонией смертности среди детей в развивающихся странах [6-9]. В развивающихся странах существует несколько популяционных оценок заболеваемости РСВ. По данным небольшого числа исследований, оценочная заболеваемость инфекциями нижних дыхательных путей, связанными с РСВ, составляет от 97 до 180 эпизодов на 1000 детей-лет, что в лучшем случае является приблизительной оценкой.Однако эти оценочные показатели для развивающихся стран в 2,6–4,8 раза превышают уровень ЛРИ, связанного с РСВ, в США [10].

В зонах с умеренным климатом инфекции РСВ возникают в основном в зимний период в виде эпидемий, которые могут длиться до 5 месяцев, но 40% случаев заражения выявляются в течение одного пикового месяца декабря или января [11-15]. Несмотря на то, что RSV был признан важным патогеном, в настоящее время не существует эффективной вакцинопрофилактики и/или противовирусного лечения против RSV-инфекций [6,16].

RSV имеет одноцепочечный несегментированный РНК-геном с отрицательным смыслом длиной 15,2 т.п.н., кодирующий генетическую информацию для десяти белков [17-19]. Двумя наиболее иммуногенными белками RSV являются Fusion (F) и Glycoprotein (G), которые экспрессируются на поверхности вириона и ответственны за индукцию продукции нейтрализующих антител [1,7,16-18]. Как внутри, так и между основными подгруппами RSV белок G является наиболее вариабельным вирусным белком с минимально консервативным эктодоменом, который содержит 2 гипервариабельные области (HVR).Второй HVR (HVR2) несет С-конец белка и обычно секвенируется для изучения генетической изменчивости штаммов RSV в данной популяции [20-22].

RSV был классифицирован на две антигенные подгруппы A и B (RSV-A и RSV-B) соответственно, первоначально на основании реактивности вируса с моноклональными антителами, направленными против гликопротеина прикрепления (G-белка) [1-3, 17,19,23-25] и в настоящее время с помощью генетического анализа [4,11,18,21,26-28]. Подгруппы были далее подразделены на различные генотипы.На сегодняшний день идентифицировано 11 генотипов RSV-A (ON1, GA1–GA7, SAA1, NA1 и NA2) и 17 генотипов RSV-B (GB1–GB4, SAB1-SAB3 и BA1–BA10) [12].

Гилгит-Балтистан (Великобритания), ранее известный как Северные районы, является самым отдаленным северным регионом Пакистана, граничащим с китайской провинцией Синьцзян. Этот регион может похвастаться одними из самых высоких горных вершин и, следовательно, здесь, вероятно, самые суровые зимние условия в стране. В сочетании с удаленностью населения и нехваткой доступной медицинской помощи информация об эпидемиологии различных заболеваний ограничена.Больница штаб-квартиры округа (DHQ) — это государственная больница третичного уровня на 250 коек в Гилгит-Сити, которая служит региональным медицинским центром и обслуживает население не только Гилгита, но и его окрестностей.

Здесь мы представляем первый отчет об инфекциях RSV из больницы третичного уровня в Великобритании у младенцев и детей в возрасте до 2 лет с острыми инфекциями дыхательных путей (ОРЗ) в течение зимнего сезона 2011-12 гг. Проанализированы эпидемиологические данные и молекулярная характеристика выявленных генотипов РСВ.

Методы

Сбор проб и эпидемиологическая информация

С декабря 2011 г. по март 2012 г. было взято 105 мазков из носоглотки у детей, обратившихся в амбулаторное отделение с клиническим диагнозом ОРЗ (на основе определений ВОЗ) либо в виде бронхиолита, либо у детей, поступивших в районную больницу Гилгит с пневмонией или с обоими . Образцы собирали в течение 1-7 дней после начала заболевания. От родителей всех детей, предоставивших образцы, было получено информированное письменное согласие.Протокол исследования был одобрен комитетом по этике больницы DHQ, Гилгит. Демографическая и клиническая информация была собрана у всех пациентов. Образцы были собраны после информированного и письменного согласия родителей/опекунов детей.

Образцы были немедленно помещены при 4°C в пробирки, содержащие 1,5 мл холодной транспортной среды для вирусов. Все образцы из носоглотки были доставлены в Национальный институт здравоохранения Исламабада для дальнейшего тестирования и анализа. После получения все образцы встряхивали и центрифугировали при 1500x g в течение 10 мин при 4°C, а супернатанты хранили при -80°C до обработки.

Экстракция РНК Протокол ПЦР в реальном времени для обнаружения РСВ

РНК

экстрагировали непосредственно из 140 мкл супернатантов образцов с помощью мини-набора RNeasy Viral (Qiagen, Валенсия, Калифорния, США) в соответствии с инструкциями производителя. РНК элюировали 50-60 мкл воды без ДНКазы и РНКазы. 5 мкл экстрагированной РНК использовали в качестве матрицы в 25 мкл смеси для ПЦР в реальном времени. Реакцию проводили на ABI-7500 с использованием набора олигонуклеотидных праймеров и зондов для гидролиза с двойной меткой (Taqman®) в соответствии с протоколом CDC для респираторных вирусов, не относящихся к гриппу (любезно предоставленным Drs.Эрдманн и Перет из CDC). В ходе анализа каждый образец тестировался на РСВ (для универсального обнаружения РСВ человека). Ген РНКазы-P человека служил внутренним положительным контролем для нуклеиновой кислоты человека. В каждый запуск не включали шаблон/отрицательный контроль (NTC) и положительный контроль шаблона (PTC) для всех наборов праймеров/зондов. Образец считался предположительно положительным на РСВ, если кривые реакции пересекали положительную пороговую линию в течение 40 циклов.

ОТ-ПЦР для G-белка

специфичных для RSV-A и RSV-B олигонуклеотидных праймеров использовали для обнаружения подтипа и секвенирования G-белка, как показано в таблице 1.Ожидаемый размер продуктов ПЦР для RSV-A и RSV-B составлял 0,3 кб и 0,8 кб соответственно.

+ + + + 3
S. № 0 S. No. SHIREMENT Sequence (5′-3 ‘) Ссылка
1 1 RT-PCR в реальном времени РСВ
+ Р Форвард GGCAAATATGGAAACATACGTGAA протокол США CDC (неопубликованные )
+ Р обратного TCTTTTTCTAGGACATTGTAYTGAACAG
+ Р зонд FAM-CTGTGTATGTGGAGCCTTCGTGAAGCT-BHQ -1
2

PCR
30
RSVA-G513-F AGTGTTCAACTTTGTACCCTGC
RSVA-F131-R CTGCACTGCATGTTGATTGAT
Уплотненный ПЦР
RSVA-G606-F AACCACCACCAAGCCCACAA
RSVA-F22 -R CAACTCCATTGTTATTTGCC
Обычные ОТ-ПЦР и секвенирования Праймеры для RSV-B
Прямой праймер BGF GCAGCCATAATATTCATCATCTCT 31
Обратный праймер BGR TGCCCAGRTTTAATTTCGTTC
BGF Seq. 1 AgagacccaaaaAaccyAgccaa
04 Acaggggagaacgaagttgaacacttca

Таблица 1. RSV A & B Олигонуклеотидные грунтовки и зонды, используемые в этом исследовании.

Вложенная ОТ-ПЦР для RSV-A

В случае RSV-A вторую гипервариабельную область (HVR2) G-белка амплифицировали с помощью вложенной ПЦР, как описано ранее [29]. Для синтеза кДНК 12,5 мкл общей РНК использовали в качестве матрицы для ПЦР с обратной транскрипцией (ОТ-ПЦР) со случайными гексамерами для RSV-A.Внешнюю ПЦР проводили с 5 мкл кДНК в 50 мкл реакционной смеси, содержащей по 25 пмоль каждой из пар праймеров RS-AG513-F и RSVA-F131-R (табл. 1), по 100 мкМ каждой dNTP, 4 мМ MgCl 2 , 0,5 ед. ДНК-полимеразы Platinum Taq (Invitrogen) и буфера для ПЦР (200 мМ Tris-HCl, 500 мМ KCl [pH 8,4]). Амплификацию проводили при 94°С в течение 5 мин, затем проводили 40 циклов ПЦР, из которых 1 цикл состоял из 30 с при 94°С, 30 с при 58°С и 1 мин при 72°С, а затем завершающий этап удлинения. шаг 10 мин при 72°С.Амплифицированные продукты длиной 583 п.н. анализировали электрофорезом на 1,5% агарозном геле. В случае отрицательного результата 5 мкл смеси внешней ПЦР использовали для гнездовой ПЦР, которую проводили в 50 мкл реакционной смеси с 25 пмоль праймеров RSVA-G606-F и RSV-F22-R (табл. 1). Протокол циклирования был таким же, как и для внешней ПЦР, за исключением температуры отжига, которая составляла 53°С. Вложенные ампликоны размером 391 п.н. также визуализировали с помощью электрофореза в агарозном геле.

ОТ-ПЦР для RSV-B

Анализ обратной транскрипции (ОТ)-ПЦР проводили с использованием набора One Step RT-PCR Kit (Qiagen) в объеме 50 мкл, содержащем по 30 пмоль прямого и обратного праймеров и 10 мкл выделенной РНК (30). Реакции ПЦР проводили на термоциклере GeneAmp PCR system 9600 (Applied Biosystems, Foster City, CA) с использованием следующего протокола; 55°С в течение 30 мин для обратной транскрипции и 94°С в течение 15 мин для активации ДНК-полимеразы; 40 циклов: 94°С в течение 30 с, 63°С в течение 1 мин и 72°С в течение 1 мин, и финальная стадия удлинения при 72°С в течение 10 мин. Все продукты амплификации подвергали электрофорезу в 1,5% агарозном геле. Ампликоны очищали с использованием набора QIAquick PCR Purification Kit (Qiagen).

секвенирование ДНК

Продукты ПЦР очищали с помощью набора QIAquick PCR Purification Kit (Qiagen) в соответствии с инструкциями производителя.Очищенные продукты ПЦР секвенировали в прямом и обратном направлениях на генетическом анализаторе ABI Prism 3130 (Applied Bio systems) с использованием готового реакционного набора для циклического секвенирования ABI Prism BigDye Terminator 3.1 (Applied Biosystems) с использованием праймеров для секвенирования. Данные последовательности, полученные в этом исследовании, были депонированы в GenBank под номерами доступа от KF437511 до KF437520.

Филогенетический анализ

Три из четырех изолятов RSV-B и семь вирусов RSV-A из разных возрастных групп были включены для секвенирования и филогенетического анализа.Нуклеотидные и выведенные аминокислотные (aa) последовательности HVR2 Pak Gilgit (PG) RSV-A и -B были сопоставлены с последовательностями RSV, извлеченными из базы данных GenBank. Для RSV-A штамм A2 (номер доступа GenBank X0221) использовали в качестве эталона, тогда как Ch28537 (номер доступа D00396) и прототип штамма BA (BA4128/99B) использовали для RSV-B.

Данные последовательности были скомпилированы и отредактированы с использованием пакета программного обеспечения Wisconsin Sequence Analysis Software Package версии 10.0 (GCG, Мэдисон, Висконсин). Нуклеотидные и выведенные аминокислотные последовательности были выровнены, и филогенетические деревья для HVR2 G-белка были созданы с использованием метода соседнего соединения с MEGA, версия 5. 05 [31]. Статистическая значимость топологии дерева была проверена путем начальной загрузки в 1000 псевдоповторений, в то время как эволюционные расстояния были получены с использованием метода параметров Кимуры-2 [32]. Для обеих групп RSV A и B были построены филогенетические деревья с использованием эталонных последовательностей репрезентативных штаммов всех известных генотипов с использованием 240 (RSV-A) и 300 (RSV-B) нуклеотидов из С-концевой вариабельной области гена, кодирующего G белок.

Мутационный анализ выведенных аминокислот и анализ сайтов N-гликозилирования

Выведенные аминокислотные последовательности С-концевого второго HVR гена G ВПЧ были созданы путем трансляции нуклеотидных последовательностей со стандартным генетическим кодом с использованием программного обеспечения MEGA.Эти выведенные аминокислотные последовательности из HVR2 белка G штаммов RSV-A и RSV-B сравнивали с прототипом штамма A2 и RSV-B 18537 соответственно на наличие мутационных изменений. Потенциальные сайты N-гликозилирования были предсказаны, если кодируемые аминокислоты были NXT, где X не является пролином [19]. Для предикации остатков О-гликозилирования использовали сервер Net-O-Glyc 3.1 [33].

Статистический анализ эпидемиологических факторов

Статистический анализ выполнен с помощью SPSS16.0 софт. Значимость различий в частоте различных демографических и клинических признаков и факторов риска между различными группами была проверена с использованием критерия хи-квадрат и критерия Стьюдента. Значение p <0,05 считалось статистически значимым.

Результаты

Обнаружение HRSV и других вирусных агентов

Хотя бы один респираторный вирус был обнаружен в 84 из 105 образцов (80%). RSV был доминирующим вирусом и составлял 71,4% (n = 75) от общего числа случаев.Из них; 71 (94,6%) пациент дал положительный результат на РСВ-А и 4 (3,8%) — на РСВ-В. Остальные случаи с положительным результатом на вирусные респираторные инфекции включали пять случаев с гриппом А и четыре с метапневмовирусом человека (HMPV). Только у четырех RSV-положительных детей была обнаружена коинфекция HMPV (6,25% всех положительных случаев).

Эпидемиология

В течение зимних сезонов 2011–2012 годов было зарегистрировано в общей сложности 105 пациентов, которые соответствовали определению случая острой инфекции дыхательных путей (ОРЗ), при этом 68% случаев были зарегистрированы в январе и феврале (рис. 1).Соотношение полов составляло 1,3:1 для мальчиков и девочек, что не было статистически значимым между инфицированными RSV и RSV-негативными группами (критерий хи-квадрат; p-0,79 ). соотношение амбулаторных и стационарных больных 4,5:1. Средний возраст RSV-позитивных пациентов составлял 4,88 месяца +/- 2,5, а возрастной диапазон составлял от 26 дней до 13 месяцев. Распределение положительных случаев по возрасту отражало распределение полученных образцов: 51% (n=положительные/всего: 42/54) положительных случаев РСВ были младенцы в возрасте от 2,01 до 6 месяцев, 24% (19/25) были дети в возрасте от 7 до 12 месяцев, затем 16% (n=12/17) в возрасте 0-2 месяцев и только 9% были в возрасте от 1 до 2 лет. Все обследованные пациенты были в возрасте до двух лет (табл. 2).

9
Возрастные группы (месяцы) Общее количество случаев (%) Общее количество случаев (%) Количество RSV Положительные случаи Количество RSV Отрицательные случаи P-значение
Средний возраст a — SD 105 4,88 ± 2.2 4,26 ± 2.23 0.272
0-2 месяца 17 (16) 12 (71) 5 (29) 0. 032
> 2-6 месяцев 54 (51) 42 (78) 12 (22)
> 6-12 месяцев 25 (24) 19 (76 ) 6 (24)
> 12-24 месяцев 9 (9) 2 (22) 7 (78) 7 (78)

9
гендер
Мужской (%) 61 (58) 40 (73) 15 (27) 0. 28
женщин (%) 44 (47) 34 (53) 30 (47)

9
средний вес ± SD (кг ) 105 (100) 6,64±1,80 6,45±1,84 0,65

Клинические признаки инфекции РСВ

Информация о клинических характеристиках была доступна для всех RSV-позитивных пациентов, и наиболее частыми клиническими проявлениями среди них были кашель (99%), лихорадка (91.4%) и свистящее дыхание (90,5%). При однофакторном анализе различных клинических признаков, таких как кашель, лихорадка, хрипы, свистящее дыхание, воздействие дыма и наличие сопутствующих заболеваний, статистически значимых различий между RSV-положительными и отрицательными детьми не наблюдалось (таблица 3). Кроме того, показатели положительных результатов были одинаковыми для таких факторов, как преждевременные роды по сравнению с доношенными и домашние роды по сравнению с больничными (значения p ; 0,38 и 0,86). Бронхиолит и бронхопневмония были наиболее частыми клиническими диагнозами у детей, инфицированных РСВ ( p -значение: 0.15).

1

3001004. PubMed: 763253.
  • 8. Парвин С., Саллендер В.М., Фаулер К., Лефковиц Э.Дж., Капур С.К. и др. (2006)Генетическая изменчивость гена белка G респираторно-синцитиальных вирусов групп А и В из Индии. J Clin Microbiol 44: 3055–3064. doi: https://doi.org/10.1128/JCM.00187-06. PubMed: 16954227.
  • 9. Venter M, Madhi SA, Tiemessen CT, Schoub BD (2001)Генетическое разнообразие и молекулярная эпидемиология респираторно-синцитиального вируса в течение четырех сезонов подряд в Южной Африке: идентификация новых генотипов подгрупп A и B.Дж. Ген Вирол 82: 2117–2124. PubMed: 11514720.
  • 10. Всемирная организация здравоохранения (ВОЗ) (2008 г.) Общий протокол для изучения заболеваемости инфекциями нижних дыхательных путей, вызванными респираторно-синцитиальным вирусом, у детей в возрасте до пяти лет. Доступно: http://www.who.int/vaccine_research/documents/en/syncytial_virus.pdf.
  • 11. Cane PA, Matthews DA, Pringle CR (1992) Анализ родства респираторно-синцитиального вируса подгруппы А, выделенного во всем мире. Вирус Рез. 25: 15–22.doi: https://doi.org/10.1016/0168-1702(92)-R. PubMed: 1413992.
  • 12. Эшаги А., Дуввури В.Р., Лай Р., Надараджа Дж.Т., Ли А и др. (2012) Генетическая изменчивость штаммов респираторно-синцитиального вируса человека А, циркулирующих в Онтарио: новый генотип с дупликацией 72-нуклеотидного гена G. ПЛОС ОДИН 7(3): e32807. doi: https://doi.org/10.1371/journal.pone.0032807. PubMed: 22470426.
  • 13. Гарсия О., Мартин М., Допазо Дж., Арбиза Дж. , Фрабазиле С. и другие. (1994) Эволюционная картина респираторно-синцитиального вируса человека (подгруппа А): коциркулирующие линии и корреляция генетических и антигенных изменений в гликопротеине G.Дж. Вирол 68: 5448–5459. PubMed: 8057427.
  • 14. Перет Т.С., Холл С.Б., Шнабель К.С., Голуб Дж.А., Андерсон Л.Дж. (1998) Модели циркуляции генетически различных штаммов групп А и В респираторно-синцитиального вируса человека в сообществе. Дж. Ген Вирол 79: 2221–2229. PubMed: 9747732.
  • 15. Рока А., Лоссерталес М.П., ​​Квинто Л., Перес-Бренья П., Ваз Н. и другие. (2001) Генетическая изменчивость среди респираторно-синцитиальных вирусов групп А и В в Мозамбике: идентификация нового кластера изолятов группы В.Дж. Ген Вирол 82: 103–111. PubMed: 11125163.
  • 16. McLellan JS, Yang YP, Graham BS, Kwong PD (2010)Структурная основа нейтрализации респираторно-синцитиального вируса мотавизумабом. Nat Struct Mol Biol 17: 248–250. doi: https://doi. org/10.1038/nsmb.1723. PubMed: 20098425.
  • 17. Cane PA (2001)Молекулярная эпидемиология респираторно-синцитиального вируса. Преподобный Мед Вирол 11: 103–116. дои: https://doi.org/10.1002/rmv.305. PubMed: 11262529.
  • 18. Collins PL, Chanock RM, Murphy BR (2001)Респираторно-синцитиальный вирус, в DM KnipePM HowleyDE GriffinRA LambMA Martin.Вирусология Филдса, 4-е изд. п. 1443–1485 гг.
  • 19. Гото-Сугай К., Цукагоши Х., Мизута К.С., Мацуда М., Нода М. и др. (2010)Генотипирование и филогенетический анализ основных генов респираторно-синцитиального вируса, выделенного от младенцев с бронхиолитом. Jpn J Infect Dis 63: 393–400. PubMed: 21099088.
  • 20. Джонсон П.Р., Сприггс М.К., Олмстед Р.А., Коллинз П.Л. (1987)Гликопротеин G респираторно-синцитиальных вирусов человека подгрупп А и В: значительное расхождение последовательностей между антигенно родственными белками.Proc Natl Acad Sci U S A 84: 5625–5629. doi: https://doi. org/10.1073/pnas.84.16.5625. PubMed: 2441388.
  • 21. Макинтош К., Чанок Р.М. (1990)Респираторно-синцитиальный вирус. стр. 1045–1072. in BN Fields, Virology, vol 1 2nd ed, vol 1 New York NY: Raven Press Ltd.
  • 22. Руусканен О., Огра П.Л. (1993)Респираторно-синцитиальный вирус. Curr Probl Pediatr 23: 50–79. PubMed: 7681743.
  • 23. Cane PA, Pringle CR (1991)Гетерогенность респираторно-синцитиального вируса во время эпидемии: анализ с помощью ограниченного секвенирования нуклеотидов (ген SH) и рестрикционного картирования (ген N).Дж. Ген Вирол 72: 349–357. doi: https://doi.org/10.1099/0022-1317-72-2-349. PubMed: 19
    .
  • 24. Мартинес И., Вальдес О., Дельфраро А., Арбиза Дж., Русси Дж. и др. (1999) Эволюционная модель гликопротеина G респираторно-синцитиальных вирусов человека из антигенной группы B: использование альтернативных терминирующих кодонов и диверсификация клонов. Дж. Ген Вирол 80: 125–130. PubMed: 9

    4.
  • 25. Паломо С., Кейн П.А., Мелеро Дж.А. (2000)Оценка специфичности антител сыворотки человека в фазе выздоровления к белку прикрепления (G) респираторно-синцитиального вируса человека: влияние вариации штамма и углеводных боковых цепей.J Med Virol 60: 468–474. doi: https://doi.org/10.1002/(SICI)1096-9071(200004)60:4. PubMed: 10686032.
  • 26. Маклеллан Дж.С., Чен М., Чанг Дж.С., Ян Ю.П., Ким А. и др. (2010)Структура основного антигенного сайта на слитом гликопротеине респираторно-синцитиального вируса в комплексе с нейтрализующим антителом 101F. Дж. Вирол 84: 12236–12244. doi: https://doi.org/10.1128/JVI.01579-10. PubMed: 20881049.
  • 27. Мелеро Дж. А., Гарсия-Баррено Б., Мартинес И., Прингл К. Р., Кейн П. А. (1997) Антигенная структура, эволюция и иммунобиология белка прикрепления (G) респираторно-синцитиального вируса человека.J Gen Virol 78 (10): 2411–2418.
  • 28. Moura FEA, Borges LC, Portes SAR, Ramos EAG, Siqueira MM (2003)Респираторно-синцитиальные вирусные инфекции в период эпидемии в Сальвадоре, Бразилия. Анализ вирусной антигенной группы и описание клинико-эпидемиологических аспектов. Мем Инст Освальдо Круз 98: 739-743. doi: https://doi.org/10.1590/S0074-02762003000600005. PubMed: 14595448.
  • 29. Reiche J, Schweiger B (2009)Генетическая изменчивость штаммов респираторно-синцитиального вируса человека группы А, циркулировавших в Германии с 1998 по 2007 год.Дж. Клин Микробиол 47: 1800–1810. doi: https://doi.org/10.1128/JCM.02286-08. PubMed: 1

    48.

  • 30. Златева К.Т., Лемей П., Моэс Э., Вандамм А.М., Ван Ранст М. (2005)Генетическая изменчивость и молекулярная эволюция белка G прикрепления подгруппы B респираторно-синцитиального вируса человека. Дж. Вирол 79: 9157–9167. doi: https://doi.org/10.1128/JVI.79.14.9157-9167.2005. PubMed: 15994810.
  • 31. Тамура К., Петерсон Д., Петерсон Н., Стечер Г., Ней М. и др. (2011) MEGA5: Молекулярно-эволюционный генетический анализ с использованием методов максимального правдоподобия, эволюционного расстояния и максимальной экономии. Мол Биол Эвол 28: 2731-2739. doi: https://doi.org/10.1093/molbev/msr121. PubMed: 21546353.
  • 32. Кимура М. (1980) Простой метод оценки эволюционной скорости замены оснований посредством сравнительных исследований нуклеотидных последовательностей. Дж. Мол. Эвол. 16: 111–120. дои: https://doi.org/10.1007/BF01731581. PubMed: 7463489.
  • 33. Julenius K, Mølgaard A, Gupta R, Brunak S (2005) Прогнозирование, анализ сохранения и структурная характеристика сайтов O-гликозилирования муцинового типа млекопитающих.Гликобиология 15: 153-164. PubMed: 15385431.
  • 34. Galiano MC, Luchsinger V, Videla1 CM, De Souza L, Puch2 SS и др. (2005) Внутригрупповое антигенное разнообразие респираторно-синцитиального вируса человека (группа А), выделенного в Аргентине и Чили. J Med Virol 77: 311–316.
  • 35. Hall CB, Weinberg GA, Iwane MK, Blumkin AK, Edwards KM et al. (2009) Бремя респираторно-синцитиальной вирусной инфекции у детей раннего возраста. N Engl J Med 360: 588–598. дои: https://doi.org/10.1056/NEJMoa0804877. PubMed: 1
  • 2. Epub 2019, 04 сентября.

    18.07.2019
    Shane AL, Weinberg GA. «Можем ли мы еще больше повысить защиту от ротавируса, уменьшив 2 барьера к иммунизации, стационарной госпитализации и пожилому возрасту?» Журнал Общества педиатрических инфекционистов. Стаат М.А., Прилл М.М., Гербер С.И., Лэнгли Г.Э. «Амбулаторные визиты к детям младше 24 месяцев, связанные с респираторно-синцитиальным вирусом».Журнал Общества педиатрических инфекционистов. 1 июля 2019 г.; 8(3):284-286.

    29 марта 2019 г.
    Куявски С.А., Мидгли К.М., Рха Б., Лайвли Дж.Ю., Никс В.А., Курнс А.Т. , Пейн Д.С., Инглунд Дж. А., Бум Дж. А., Уильямс Дж. В., Вайнберг Г. А., Стаат М. А., Селваранган Р., Халаса Н. Б., Кляйн Э. Дж., Сахни Л. С., Майклс М. Г., Шелли Л., Макнил М., Харрисон К. Дж., Стюарт Л. С., Лопес А. С., Рут Дж. А., Патель М., Оберсте М. С., Уотсон Дж. Т., Гербер С. И. «Острое респираторное заболевание, связанное с энтеровирусом D68 — новая сеть эпиднадзора за вакцинами, США, июль-октябрь, 2017 и 2018 гг.MMWR. Еженедельный отчет о заболеваемости и смертности. 29 марта 2019 г.; 68(12):277-280. Epub 2019 29 марта.

    3/2019
    «Клинические уроки, извлеченные из случая подозрения на малярию, передающуюся при переливании крови». Переливание.. 0 марта 2019 г.; 59(3):1159. R, Harrison CJ, Azimi PH, Boom JA, Sahni LC, Englund JA, Klein EJ, Staat MA, McNeal MM, Halasa N, Chappell J, Weinberg GA, Szilagyi PG, Esona MD, Bowen MD, Payne DC.«Доказательства передачи ротавируса в домашних условиях в США, 2011–2016 гг.». Журнал Общества детских инфекционных заболеваний. 7 февраля 2019 г .; Epub, 07 февраля 2019 г. , Клейн Э.Дж., Моффатт М.Е., Харрисон С.Дж., Сахни Л.С., Стюарт Л.С., Бернштейн Д.И., Парашар У. Д., Пейн Д.К. «Факторы, связанные с охватом ротавирусной вакциной». Педиатрия.. 2019 17 января; Epub 2019 17 января.

    15.11.2018
    Вайнберг Г.А. «Эпидемиология вспышек: один из многих новых рубежей биологии норовирусов». Журнал инфекционных болезней.. 2018 15 ноя; Epub 2018 15 ноября.

    03.09.2018
    Хассан Ф., Канвар Н., Харрисон С.Дж., Халаса Н.Б., Чаппелл Д.Д., Инглунд Дж.А., Кляйн Э.Дж., Вайнберг Г.А., Силагьи П.Г., Моффатт М.Е., Оберсте М.С., Никс В.А. , Rogers S, Bowen MD, Vinjé J, Wikswo ME, Parashar UD, Payne DC, Selvarangan R. «Вирусная этиология острого гастроэнтерита у детей младше 2 лет в США в эпоху постротавирусной вакцины».Журнал Общества педиатрических инфекционистов. 3 сентября 2018 г.; Epub 2018 г. 03 сентября.

    15 мая 2018 г.
    Пейн, округ Колумбия, Уильямс Дж. В. «Клинические особенности метапневмовирусной инфекции человека у амбулаторных детей в возрасте 5–13 лет», Журнал Общества детских инфекционных заболеваний, 15 мая 2018 г. , 7 (2): 165–168,

    5/ 2018
    Вайнберг Г. А. Абсцесс головного мозга // Обзор педиатрии.2018 0 мая; 39(5):270-272.

    10/2017
    Альбин-Лидс С., Очоа Дж., Мехта Х., Фогель Б.Х., Каггана М., Бонагура В., Леман Х., Баллоу М., Рубинштейн А., Сигель С., Вайнер Л., Вайнберг Г.А., Каннингем-Рандлз С. «Идиопатическая Т-клеточная лимфопения, выявленная при скрининге новорожденных в штате Нью-Йорк». Клиническая иммунология: официальный журнал Общества клинической иммунологии. 0 октября 2017 г .; 183:36-40. Epub 2017 Jul 08.

    10/2017
    Chhabra P, Gregoricus N, Weinberg GA, Halasa N, Chappell J, Hassan F, Selvarangan R, Mijatovic-Rustempasic S, Ward ML, Bowen M, Payne DC, Vinjé J .«Сравнение трех мультиплексных желудочно-кишечных платформ для обнаружения вирусов гастроэнтерита». Журнал клинической вирусологии: официальное издание Панамериканского общества клинической вирусологии. 0 октября 2017 г .; 95:66-71. Epub 2017, 01 сентября.

    10/2017
    Вайнберг Г.А. «Смертность от респираторно-синцитиального вируса среди детей раннего возраста». Ланцет. Глобальное здоровье.. 2017 Октябрь 0; 5(10):е951-е952.

    01.02.2017
    Левин М.Дж., Линдси Дж.К., Каплан С.С., Шимана В., Лоуренс Дж., МакНил М.М., Бвакура-Дангарембиз М., Огву А., Мпабалвани Э.М., Сато П., Сиберри Г., Нельсон М., Хилле Д. , Вайнберг Г.А., Вайнберг А.«Безопасность и иммуногенность живой аттенуированной пятивалентной ротавирусной вакцины у младенцев, подвергшихся воздействию ВИЧ, с ВИЧ-инфекцией или без нее в Африке». СПИД.. 2017 2 января; 31(1):49-59.

    01.09.2016
    Bowen MD, Mijatovic-Rustempasic S, Esona MD, Teel EN, Gautam R, Sturgeon M, Azimi PH, Baker CJ, Bernstein DI, Boom JA, Chappell J, Donauer S, Edwards KM , Инглунд Дж. А., Халаса Н. Б., Харрисон С. Дж., Джонстон С. Х., Кляйн Э. Дж., Макнил М. М., Моффатт М. Э., Ренч М. А., Сахни Л. С., Селваранган Р., Стаат М. А., Силагьи П. Г., Вайнберг Г. А., Виксво М. Е., Парашар У. Д., Пейн Д. С.«Тенденции штаммов ротавируса в эпоху постлицензионной вакцины: США, 2008–2013 гг.». Журнал инфекционных болезней.. 2016 сен 1; 214(5):732-8. Epub 2016 Jun 14.

    3/2016
    Abedi GR, Prill MM, Langley GE, Wikswo ME, Weinberg GA, Curns AT, Schneider E. «Оценки госпитализаций, связанных с вирусом парагриппа, и их стоимость среди детей в возрасте до 5 лет» Годы в США, 1998-2010». Журнал Общества детских инфекционных заболеваний. 0 марта 2016 г .; 5(1):7-13.Epub 2014 Jun 02.

    3/2016
    Weinberg GA. «Празднование жизни и творчества Кэролайн Бриз Холл, доктора медицины». Журнал Общества детских инфекционных заболеваний. 0 марта 2016 г .; 5(1):e1-4. Epub 2014, 08 декабря.

    2/2016
    Миятович-Рустемпасич С., Рой С., Тил Э.Н., Вайнберг Г.А., Пейн Д.К., Парашар У.Д., Боуэн М.Д. «Полная характеристика генома первого штамма ротавируса G3P[24], обнаруженного у людей, свидетельствует о межвидовой рекомбинации и мутационном насыщении гена VP7. Журнал общей вирусологии .. 0 февраля 2016 г .; 97 (2): 389-402. Epub 2015 20 ноября. , Staat MA, Halasa NB, Weinberg GA, Szilagyi PG, Chappell J, McNeal M, Klein EJ, Sahni LC, Johnston SH, Harrison CJ, Baker CJ, Bernstein DI, Moffatt ME, Tate JE, Mijatovic-Rustempasic S, Esona MD , Wikswo ME, Curns AT, Sulemana I, Bowen MD, Gentsch JR, Parashar UD. «Долгосрочная стабильность защиты от ротавирусной вакцины: эффективность вакцин RV5 и RV1 у детей в США, 2012–2013 гг.«Клинические инфекционные заболевания: официальная публикация Американского общества инфекционистов». 15 декабря 2015 г.; 61 (12): 1792-9. Epub 8 октября 2015 г. MA, Sahni LC, Selvarangan R, Halasa NB, Englund JA, Weinberg GA, Boom JA, Szilagyi PG, Klein EJ, Chappell J, Harrison CJ, Davidson BS, Mijatovic-Rustempasic S, Moffatt MD, McNeal M, Wikswo M, Bowen MD, Morrow AL, Parashar UD. «Эпидемиологическая связь между секреторным статусом FUT2 и тяжелым ротавирусным гастроэнтеритом у детей в Соединенных Штатах».»JAMA педиатрия. . 0 ноября 2015 г.; 169 (11): 1040-5.

    01.06.2015
    Карриер Р.Л., Пейн Д.К., Стаат М.А., Селваранган Р., Ширли С.Х., Халаса Н., Бум Дж.А., Инглунд JA, Szilagyi PG, Harrison CJ, Klein EJ, Weinberg GA, Wikswo ME, Parashar U, Vinjé J, Morrow AL. «Врожденная восприимчивость к норовирусным инфекциям под влиянием генотипа FUT2 в педиатрической популяции США». Клинические инфекционные заболевания: официальный публикация Американского общества инфекционистов, 1 июня 2015 г., 60(11):1631-8.Epub 2015 Mar 05.

    4/2015
    Oliveira DB, Iwane MK, Prill MM, Weinberg GA, Williams JV, Griffin MR, Szilagyi PG, Edwards KM, Staat MA, Hall CB, Durigon EL, Erdman DD. «Молекулярная характеристика респираторно-синцитиальных вирусов, поражающих детей, которые, как сообщается, получали иммунопрофилактику паливизумабом». Журнал клинической вирусологии: официальное издание Панамериканского общества клинической вирусологии. 0 апреля 2015 г .; 65:26-31. Epub 2015 24 января.

    2/2015
    Суд В., Моханти П., Гэйбл М., Вайнберг Г.А.«Рецидивирующий бескаменный холецистит у ребенка с хронической гранулематозной болезнью». Журнал детской гастроэнтерологии и питания. 0 февраля 2015 г .; 60(2):e11-2.

    9/2014
    Хой З., Доддс Эшли Э.С., Вайнберг Г.А., Крысан Д.Дж. «Мониторинг терапевтических препаратов вориконазола». Журнал Общества детских инфекционных заболеваний. 0 сентября 2014 г .; 3(3):270-1. Epub 2014 30 марта.

    20.08.2014
    Кван А., Абрахам Р.С., Карриер Р., Брауэр А., Андрушевски К., Эбботт Дж.К., Бейкер М., Баллоу М., Бартошески Л.Е., Бонилла Ф.А., Брокопп С., Брукс Э. , Каггана М., Селестин Дж., Черч Дж.А., Комо А.М., Коннелли Дж.А., Коуэн М.Дж., Каннингем-Рандлз С., Дасу Т., Дэйв Н., Де Ла Морена М.Т., Даффнер У., Фонг К.Т., Форбс Л., Фриденберг Д., Гельфанд Э.В., Hale JE, Hanson IC, Hay BN, Hu D, Infante A, Johnson D, Kapoor N, Kay DM, Kohn DB, Lee R, Lehman H, Lin Z, Lorey F, Abdel-Mageed A, Manning A, McGhee S, Мур Т. Б., Найдес С.Дж., Нотаранжело Л.Д., Оранжевый Дж.С., Пай С.Ю., Портеус М., Родригес Р., Ромберг Н., Рутс Дж., Рюле М., Рубинштейн А., Сааведра-Матиз К.А., Скотт Г., Скотт П.М., Секорд Э., Серуги С., Ширер В.Т., Сигел С., Сильверс С.К., Стим Э.Р., Сугерман Р.В., Салливан Дж.Л., Танксли С., Тиерс М.Л., Вербски Дж., Фогель Б., Уокер Р., Валкович К., Уолтер Дж.Е., Вассерман Р.Л., Уотсон М.С., Вайнберг Г.А., Вайнер Л.Б. , Вуд Х., Йейтс А.Б., Пак Дж.М.«Скрининг новорожденных на тяжелый комбинированный иммунодефицит в рамках 11 программ скрининга в США». JAMA.. 2014 20 августа; 312(7):729-38.

    4/2014
    Фогель Б.Х., Бонагура В., Вайнберг Г.А., Баллоу М., Изабель Дж., Диантонио Л., Паркер А., Янг А., Каннингем-Рандлз С., Фонг К.Т., Селестин Дж., Леман Х., Рубинштейн А., Сигел S, Weiner L, Saavedra-Matiz C, Kay DM, Caggana M. «Скрининг новорожденных на SCID в штате Нью-Йорк: опыт первых двух лет». Журнал клинической иммунологии.. 2014 0 апр; 34(3):289-303. Epub 2014 01 марта.

    1/2014
    Вайнберг Г.А. «Комментарий редакции: неожиданные преимущества иммунизации: ротавирусные вакцины уменьшают судороги у детей». Клинические инфекционные заболевания: официальная публикация Американского общества инфекционистов. 0 января 2014 г .; 58(2):178-80. Epub 2013 20 ноября.

    1/2014
    Миятович-Рустемпасич С., Тил Э.Н., Керин Т.К., Халл Дж., Рой С., Вайнберг Г.А., Пейн Д.К., Парашар УД, Генч Дж.Р., Боуэн М.Д.«Генетический анализ ротавирусов G12P[8], обнаруженных во время крупнейшей вспышки генотипа G12 в США за всю историю наблюдений». Инфекция, генетика и эволюция: журнал молекулярной эпидемиологии и эволюционной генетики инфекционных заболеваний. 0 января 2014 г .; 21:214-9. Epub 2013 21 ноября.

    10/2013
    Wikswo ME, Desai R, Edwards KM, Staat MA, Szilagyi PG, Weinberg GA, Curns AT, Lopman B, Vinjé J, Parashar UD, Payne DC, Hall AJ. «Клинический профиль детей с норовирусной инфекцией в эпоху ротавирусной вакцины. «Новые инфекционные заболевания.. 0 октября 2013 г.; 19 (10): 1691-3. Кэссиди А., Ортега-Санчес И.Р., Парашар У.Д., Стаат М.А. «Связанные с ротавирусом расходы на госпитализацию и отделение неотложной помощи и влияние программы вакцинации против ротавируса».

    8/2013
    Вайнберг Г.А., Тил Э.Н., Миятович-Рустемпасич С., Пейн Д.К., Рой С., Фойтич К., Парашар У.Д., Генч Д.Р., Боуэн М.Д.«Обнаружение нового штамма ротавируса путем пострегистрационного наблюдения за вакциной». Возникающие инфекционные заболевания.. 2013 0 авг.; 19(8):1321-3.

    8/2013
    Тейт Дж.Э., Миятович-Рустемпасич С., Там К.И., Лайд Ф.К., Пейн Д.С., Силагьи П., Эдвардс К., Стаат М.А., Вайнберг Г.А., Холл С.Б., Чаппелл Дж., Макнил М., Генч Дж.Р., Боуэн MD, Парашар UD. «Сравнение 2 тестов для диагностики ротавируса и оценки эффективности вакцины у детей с гастроэнтеритом». Возникающие инфекционные заболевания.. 2013 0 авг.; 19(8):1245-52.

    8/2013
    Hall CB, Weinberg GA, Blumkin AK, Edwards KM, Staat MA, Schultz AF, Poehling KA, Szilagyi PG, Griffin MR, Williams JV, Zhu Y, Grijalva CG, Prill MM, Iwane MK. «Госпитализации, связанные с респираторно-синцитиальным вирусом, среди детей в возрасте до 24 месяцев». Педиатрия.. 2013 0 авг; 132(2):e341-8. Epub 2013 22 июля.

    7/2013
    Пейн Д.С., Бум Дж.А., Стаат М.А., Эдвардс К.М., Силагьи П.Г., Кляйн Э.Дж., Селваранган Р., Азими П.Х., Харрисон К., Моффатт М., Джонстон С.Х., Сахни Л.С., Бейкер CJ, Rench MA, Donauer S, McNeal M, Chappell J, Weinberg GA, Tasslimi A, Tate JE, Wikswo M, Curns AT, Sulemana I, Mijatovic-Rustempasic S, Esona MD, Bowen MD, Gentsch JR, Parashar UD.«Эффективность пятивалентных и моновалентных ротавирусных вакцин при одновременном применении среди детей в США до 5 лет, 2009–2011». Клинические инфекционные заболевания: официальное издание Американского общества инфекционистов. 0 июля 2013 г .; 57(1):13-20. Epub 2013 Mar 13.

    7/2013
    Weinberg GA, Schnabel KC, Erdman DD, Prill MM, Iwane MK, Shelley LM, Whitaker BL, Szilagyi PG, Hall CB. «Полевые испытания TaqMan Array Card (TAC) для одновременного обнаружения множественных респираторных вирусов у детей с острой респираторной инфекцией.Журнал клинической вирусологии: официальная публикация Панамериканского общества клинической вирусологии. 0 июля 2013 г.; 57(3):254-60. Epub 19 апреля 2013 г. Payne DC, Edwards KM, Szilagyi PG, Hornung RW, Weinberg GA, Chappell J, Hall CB, Parashar UD, Staat MA. «Определение эффективности пятивалентной ротавирусной вакцины против ротавирусных госпитализаций и посещений отделений неотложной помощи с использованием двух дизайнов исследований». .. 2013 31 мая; 31(24):2692-7.Epub 2013 12 апреля.

    01.04.2013
    Иван М.К., Чавес С.С., Силаги П.Г., Эдвардс К.М., Холл С.Б., Стаат М.А., Браун С.Дж., Гриффин М.Р., Вайнберг Г.А., Полинг К.А., Прилл М.М., Уильямс Дж.В. , Мосты СВ. «Различия между черными и белыми детьми в госпитализациях, связанных с острым респираторным заболеванием и лабораторно подтвержденным гриппом и респираторно-синцитиальным вирусом в 3 округах США — 2002-2009». Американский журнал эпидемиологии. 1 апреля 2013 г .; 177(7):656-65. Epub 2013 Feb 22.

    21.03.2013
    Payne DC, Vinjé J, Szilagyi PG, Edwards KM, Staat MA, Weinberg GA, Hall CB, Chappell J, Bernstein DI, Curns AT, Wikswo M, Shirley SH , Холл А.Дж., Лопман Б., Парашар УД.«Норовирус и гастроэнтерит с медицинским обслуживанием у детей в США». Медицинский журнал Новой Англии. 21 марта 2013 г .; 368(12):1121-30.

    14.02.2013
    Эдвардс К.М., Чжу Ю., Гриффин М.Р., Вайнберг Г.А., Холл С.Б., Силагьи П.Г., Стаат М.А., Иване М., Прилл М.М., Уильямс Дж.В., . «Бремя человеческой метапневмовирусной инфекции у детей раннего возраста». Медицинский журнал Новой Англии. 14 февраля 2013 г .; 368(7):633-43.

    2/2013
    Полинг К.А., Эдвардс К.М., Гриффин М.Р., Силаджи П.Г., Стаат М.А., Иване М.К., Снайвли Б.М., Суеркен К.К., Холл К.Б., Вайнберг Г.А., Чавес С.С., Чжу И, Макнил М.М., Бриджес К.Б.«Бремя гриппа у детей раннего возраста, 2004–2009 гг.». Педиатрия.. 2013 0 фев; 131(2):207-16. Epub 2013 Jan 06.

    3/2012
    Prill MM, Iwane MK, Edwards KM, Williams JV, Weinberg GA, Staat MA, Willby MJ, Talbot HK, Hall CB, Szilagyi PG, Griffin MR, Curns AT, Erdman ДД, . «Человеческий коронавирус у маленьких детей, госпитализированных по поводу острого респираторного заболевания, и бессимптомный контроль». Журнал детских инфекционных болезней. 0 марта 2012 г .; 31(3):235-40.

    3/2012
    Вайнберг Г.А., Пейн Д.К., Тил Э.Н., Миятович-Рустемпасич С., Боуэн М.Д., Виксво М., Генч Дж.Р., Парашар УД.«Первые сообщения о ротавирусном гастроэнтерите G8P [4] человека в Соединенных Штатах». Журнал клинической микробиологии. 0 марта 2012 г .; 50(3):1118-21. Epub 2011, 14 декабря.

    1/2012
    Наранг С., Фернандес И.Д., Чин Н., Лернер Н., Вайнберг Г.А. «Бактеремия у детей с серповидными гемоглобинопатиями». Журнал детской гематологии/онкологии. 0 января 2012 г.; 34(1):13-6.

    01.12.2011
    Иван М.К., Прилл М.М., Лу С., Миллер Э.К., Эдвардс К.М., Холл С.Б., Гриффин М.Р., Стаат М.А., Андерсон Л.Дж., Уильямс Дж.В., Вайнберг Г.А., Али А., Силаги П.Г., Чжу Y, Эрдман ДД.«Виды риновирусов человека связаны с госпитализацией по поводу острых респираторных заболеваний у детей раннего возраста в США». Журнал инфекционных болезней.. 2011 1 дек; 204(11):1702-10. Epub 2011 19 окт. Чжу Ю, Мосты CB, . «Достоверность родительского отчета о вакцинации против гриппа у детей младшего возраста, обращающихся за медицинской помощью». Вакцина.. 2011 28 ноября; 29(51):9488-92.Epub 2011 19 окт. «Эффективность вакцины против лабораторно подтвержденного гриппа у детей в возрасте 6-59 месяцев, 2005-2007 гг.» Вакцина.. 2011 8 ноября; 29(48):9005-11. Epub 2011, 21 сентября.

    01.08.2011
    Пейн, округ Колумбия, Стаат М.А., Эдвардс К.М., Силаги П.Г., Вайнберг Г.А., Холл К.Б., Чаппелл Дж., Кернс А.Т., Виксво М., Тейт Д.Е., Лопман Б.А., Парашар УД , .«Прямые и косвенные эффекты ротавирусной вакцинации на госпитализацию детей в 3 округах США, 2006–2009 гг.». Клинические инфекционные заболевания: официальная публикация Американского общества инфекционистов. 1 августа 2011 г .; 53(3):245-53. Epub 2011 23 июня.

    8/2011
    Staat MA, Payne DC, Donauer S, Weinberg GA, Edwards KM, Szilagyi PG, Griffin MR, Hall CB, Curns AT, Gentsch JR, Salisbury S, Fairbrother G, Parashar УД, . «Эффективность пятивалентной ротавирусной вакцины против тяжелого заболевания.«Педиатрия.. 0 августа 2011 г.; 128 (2): e267-75. Epub 2011 г. 18 июля.

    31 мая 2011 г.
    Дубовский Ф., Йи Т., МакКаллерс Дж. А., Флинн П. М. «Безопасность живой аттенуированной вакцины против гриппа у детей с ослабленным иммунитетом от легкой до умеренной степени тяжести, больных раком».

    12.07.2010
    Fairbrother G, Cassedy A, Ortega-Sanchez IR, Szilagyi PG, Edwards KM, Molinari NA, Donauer S, Henderson D, Ambrose S, Kent D, Poehling K, Weinberg GA, Griffin MR , Hall CB, Finelli L, Bridges C, Staat MA, .«Высокие затраты на грипп: прямые медицинские затраты на грипп у детей раннего возраста». Вакцина.. 2010 12 июля; 28(31):4913-9. Epub 2010 May 31.

    15/6/2010
    Williams JV, Edwards KM, Weinberg GA, Griffin MR, Hall CB, Zhu Y, Szilagyi PG, Wang CK, Yang CF, Silva D, Ye D, Spaete RR , Кроу-младший JE. «Популяционная заболеваемость метапневмовирусной инфекцией человека среди госпитализированных детей». Журнал инфекционных болезней.. 2010 15 июня; 201(12):1890-8.

    01.06.2010
    Вайнберг Г.А., Силагьи П.Г.«Эпидемиология вакцин: эффективность, результативность и дорожная карта трансляционных исследований». Журнал инфекционных болезней.. 2010 1 июня; 201(11):1607-10.

    3/2010
    Вайнберг Г.А., Миан А.Н. «Вирусная нефропатия BK и другие инфекции, вызванные вирусом полиомы». Журнал детских инфекционных заболеваний. 0 марта 2010 г .; 29(3):257-60.

    3/2010
    Пейн Д.К., Силагьи П.Г., Стаат М.А., Эдвардс К.М., Генч Дж.Р., Вайнберг Г.А., Холл С.Б., Кернс А.Т., Клейтон Х., Гриффин М.Р., Фейрбратер Г., Парашар У.Д.«Скорректированные показатели госпитализации из-за ротавируса в 2007 году». Журнал детских инфекционных заболеваний. 0 марта 2010 г .; 29(3):287-8.

    3/2010
    Миллер Т.Л., Сомарриба Г., Киннамон Д.Д., Вайнберг Г.А., Фридман Л.Б., Скотт Г.Б. «Влияние структурированной программы упражнений на результаты питания и фитнеса у детей, инфицированных вирусом иммунодефицита человека». Исследования СПИДа и ретровирусы человека. 0 марта 2010 г .; 26(3):313-9.

    01.11.2009
    Кортезе М.М., Стаат М.А., Вайнберг Г.А., Эдвардс К., Райс М.А., Силагьи П.Г., Холл К.Б., Пейн Д.К., Парашар УД.«Недооценка показателей инвагинации кишечника среди младенцев в США на основе данных о выписке из стационара: последствия для мониторинга безопасности ротавирусных вакцин». Журнал инфекционных болезней.. 2009 1 нояб.; 200 Приложение 1:S264-70.

    11/2009
    Weinberg GA, D’Angio CT. «Поиск новых диагностических тестов для неонатального сепсиса». Журнал педиатрии. 2009 0 ноября; 155(5):763-4; ответ автора 764.

    11/2009
    Пейн Д.К., Силагьи П.Г., Стаат М.А., Эдвардс К.М., Генч Дж.Р., Вайнберг Г.А., Холл К.Б., Кернс А.Т., Клейтон Х., Гриффин М.Р., Фэйрбразер Г., Парашар УД.«Вековые различия в показателях заболеваемости и серотипах ротавирусной инфекции в США: значение для оценки программы вакцинации против ротавирусной инфекции». Журнал детских инфекционных заболеваний. 0 ноября 2009 г .; 28(11):948-53.

    6/2009
    Винх Д.С., Фримен А.Ф., Ши Ю.Р., Малек Х.Л., Абинун М., Вайнберг Г.А., Холланд С.М. «Мукормикоз при хронической гранулематозной болезни: связь с ятрогенной иммуносупрессией». Журнал аллергии и клинической иммунологии. 0 июня 2009 г .; 123(6):1411-3. Epub 2009 14 апр.

    5/2009
    Вайнберг Г.А., Холл К.Б., Иван М.К., Полинг К.А., Эдвардс К.М., Гриффин М.Р., Стаат М.А., Курнс А.Т., Эрдман Д.Д., Силагьи П.Г., . «Вирусная инфекция парагриппа у детей раннего возраста: оценки бремени госпитализации среди населения». Журнал педиатрии.. 2009 0 мая; 154(5):694-9. Epub, 2009, 21 января.«Коронавирусная инфекция и госпитализации по поводу острых респираторных заболеваний у детей раннего возраста». Журнал медицинской вирусологии.. 2009 0 мая; 81(5):853-6.

    05.02.2009
    Холл С.Б., Вайнберг Г.А., Иван М.К., Блюмкин А.К., Эдвардс К.М., Стаат М.А., Ауингер П., Гриффин М.Р., Полинг К.А., Эрдман Д., Грихальва К.Г., Чжу Ю., Силагьи П. » Бремя респираторно-синцитиальной вирусной инфекции у детей раннего возраста». Медицинский журнал Новой Англии. 5 февраля 2009 г .; 360(6):588-98.

    1/2009
    Миллер Э.К., Эдвардс К.М., Вайнберг Г.А., Иване М.К., Гриффин М.Р., Холл С.Б., Чжу Ю., Силагьи П.Г., Морин Л.Л., Хейл Л.Х., Лу Х, Уильямс Дж.В., .«Новая группа риновирусов связана с госпитализацией по поводу астмы». Журнал аллергии и клинической иммунологии. 0 января 2009 г .; 123(1):98-104.e1. Epub 2008 22 ноября.

    12/2008
    Пейн Д.К., Стаат М.А., Эдвардс К.М., Силаги П.Г., Генч Дж.Р., Стокман Л.Дж., Курнс А.Т., Гриффин М., Вайнберг Г.А., Холл CB, Фэйрбразер Г., Александр Дж., Парашар УД. «Активный, популяционный эпиднадзор за тяжелым ротавирусным гастроэнтеритом у детей в Соединенных Штатах». Педиатрия.. 2008 0 дек.; 122(6):1235-43.

    11/2008
    Айзенберг К.В., Силаги П.Г., Фэйрбразер Г., Гриффин М.Р., Стаат М., Шон Л.П., Вайнберг Г.А., Холл К.Б., Полинг К.А., Эдвардс К.М., Лофтус Г., Фишер С.Г., Бриджес К.Б., Иване М.К., . «Эффективность вакцины против лабораторно подтвержденного гриппа у детей в возрасте от 6 до 59 месяцев в сезоны гриппа 2003–2004 и 2004–2005 годов». Педиатрия.. 2008 0 нояб.; 122(5):911-9.

    10/2008
    Миллер Т.Л., Орав Э.Дж., Липшульц С.Е., Архарт К.Л., Дагган С., Вайнберг Г.А., Бехард Л., Фурута Л., Никчитта Дж., Горбач С.Л., Шевиц А.«Факторы риска сердечно-сосудистых заболеваний у детей, инфицированных вирусом иммунодефицита человека-1». Журнал педиатрии. 2008 0 окт; 153(4):491-7. Epub 2008 Jun 09.

    8/2008
    Шарма Т.С., Киннамон Д.Д., Дагган С., Вайнберг Г.А., Фурута Л., Бехард Л., Никчитта Дж., Горбач С.Л., Миллер Т.Л. «Изменения в потреблении макроэлементов среди ВИЧ-инфицированных детей в период с 1995 по 2004 год». Американский журнал клинического питания. 0 августа 2008 г .; 88(2):384-91.

    3/2008
    Гибсон Г.М., Вайнберг Г.А.«Фармакогенетика и фармакогеномика для практикующего инфекциониста». Журнал детских инфекционных заболеваний. 0 марта 2008 г .; 27(3):263-4.

    1/2008
    Миллер Э.К., Гриффин М.Р., Эдвардс К.М., Вайнберг Г.А., Силаджи П.Г., Стаат М.А., Иване М.К., Чжу Ю., Холл К.Б., Фейрбразер Г., Зейтер Р., Эрдман Д., Лу П., Полинг К.А., . «Бремя гриппа для детей с астмой». Педиатрия.. 2008 0 янв.; 121(1):1-8.

    11/2007
    Gea-Banacloche JC, Weinberg GA.«Терапия моноклональными антителами и риск заражения». Журнал детских инфекционных заболеваний. 0 ноября 2007 г .; 26(11):1049-52.

    8/2007
    Grijalva CG, Weinberg GA, Bennett NM, Staat MA, Craig AS, Dupont WD, Iwane MK, Postema AS, Schaffner W, Edwards KM, Griffin MR. «Оценка невыявленного бремени госпитализаций по поводу гриппа у детей». Эпидемиология и инфекция. 2007 0 августа; 135(6):951-8. Epub 2006 Dec 07.

    15.03.2007
    Миллер EK, Lu X, Erdman DD, Poehling KA, Zhu Y, Griffin MR, Hartert TV, Anderson LJ, Weinberg GA, Hall CB, Iwane MK, Edwards KM , .«Связанные с риновирусом госпитализации у детей раннего возраста». Журнал инфекционных болезней. 2007 15 марта; 195(6):773-81. Epub 2007 Feb 02.

    1/2007
    Grijalva CG, Poehling KA, Edwards KM, Weinberg GA, Staat MA, Iwane MK, Schaffner W, Griffin MR. «Точность и интерпретация экспресс-тестов на грипп у детей». Педиатрия.. 0 янв. 2007; 119(1):e6-11.

    15.12.2006
    Патель К., Вайнберг Г.А., Бучач К., Макинтош К., Данкнер В.М., Сидж Г.Р. «Простая педиатрическая шкала тяжести СПИДа (PASS): педиатрическая шкала тяжести заболевания для условий с ограниченными ресурсами.Журнал синдромов приобретенного иммунодефицита: JAIDS.. 15 декабря 2006 г.; 43(5):611-7.

    15.12.2006
    Seage GR, Buchacz K, Weinberg GA, Patel K, McIntosh K, Dankner WM «Шкала тяжести СПИДа у детей (PASS): многомерная поправка на тяжесть СПИДа для детской ВИЧ-инфекции». Журнал синдромов приобретенного иммунодефицита: JAIDS.. 15 декабря 2006 г.; 43(5):603-10.

    06.07.2006
    Полинг К.А., Эдвардс К.М., Вайнберг Г.А., Силагьи П., Стаат М.А., Иване М.К., Бриджес К.Б., Грихальва К.Г., Чжу И., Бернштейн Д.И., Эррера Г., Эрдман Д., Холл К.Б., Зейтер Р., Гриффин Г-Н, .«Недооцененное бремя гриппа у детей раннего возраста». Медицинский журнал Новой Англии. 6 июля 2006 г .; 355(1):31-40.

    6/2006
    Вайнберг Г.А. «Статус железа и смертность при ВИЧ-инфекции». Haematologica.. 0 июня 2006 г .; 91(6):721.

    5/2006
    Вайнберг Г.А. «Вирусы парагриппа: недооцененная причина детской респираторной заболеваемости». Журнал детских инфекционных болезней. 2006 0 мая; 25(5):447-8.

    5/2006
    Вайнберг Г.А.«Экспресс-тестирование детей на грипп мало что дает для принятия клинических решений». Журнал педиатрии.. 2006 0 мая; 148(5):698-9.

    15.04.2006
    Вайнберг Г.А. «Номенклатура Pneumocystis carinii: 2 неправильных названия не лучше, чем 1». Клинические инфекционные заболевания: официальное издание Американского общества инфекционистов. 15 апреля 2006 г .; 42(8):1209-10; ответ автора 1212-4.

    05.10.2005
    Вайнберг Г.А., Луке А.Е., Браун С.Т., . «Непрофессиональная постконтактная профилактика ВИЧ.JAMA.. 5 октября 2005 г.; 294(13):1615; ответ автора 1615-6.

    10/2005
    Вайнберг Г.А., Хоспе Н. «Дефицит гормона роста и ВИЧ-инфекция». Журнал педиатрии.. 0 октября 2005 г., 147(4):559-60. минеральной плотности костной ткани у детей, инфицированных вирусом иммунодефицита человека-1». Журнал детской гастроэнтерологии и питания.. 0 сентября 2005 г .; 41(3):339-46.

    6/2005
    Вайнберг Г.А. «Вопрос от врача: доза вакцины против гепатита В при рождении». Педиатрия в обзоре. 2005 г., 0 июня; 26(6):226-7.

    4/2005
    Вайнберг Г.А. «Прионовый праймер: трансмиссивные губкообразные энцефалопатии». Журнал детских инфекционных заболеваний. 0 апреля 2005 г .; 24(4):371-2.

    2005
    Джоффе Т.Х.; Велле, С.; Рубенхофф, Р.; Горбач С.Л.; Вайнберг, Г.А.; Дагган, К.; Фурута, Л.; Никчитта, Дж.; Липинчик Т.М.; Миллер, Т.Л.;. «Уравнение анализа биоэлектрического импеданса для прогнозирования общего количества воды и безжировой массы тела у детей с вирусом иммунодефицита человека-1 в эпоху до ВААРТ и ВААРТ». Состав Internat.J.Body Res. 2005 г.; 3: 15-24.

    11/2004
    Гриффин М.Р., Уокер Ф.Дж., Иван М.К., Вайнберг Г.А., Стаат М.А., Эрдман Д.Д., . «Эпидемиология респираторных инфекций у детей раннего возраста: выводы из новой сети эпиднадзора за вакцинами». Журнал детских инфекционных болезней.. 2004 г., 0 ноября; 23 (11 Дополнение): S188-92.

    6/2004
    Иван М.К., Эдвардс К.М., Силаги П.Г., Уокер Ф.Дж., Гриффин М.Р., Вайнберг Г.А., Коулен С., Полинг К.А., Шон Л.П., Балтер С., Холл С.Б., Эрдман Д.Д., Вутен К., Шварц Б., . «Популяционный эпиднадзор за госпитализациями, связанными с респираторно-синцитиальным вирусом, вирусом гриппа и вирусами парагриппа среди детей раннего возраста». Педиатрия.. 0 июня 2004 г .; 113(6):1758-64.

    4/2004
    Маллинз Д.А., Эрдман Д.Д., Вайнберг Г.А., Эдвардс К., Холл С.Б., Уокер Ф.Дж., Иван М., Андерсон Л.Дж.«Метапневмовирусная инфекция человека среди детей, госпитализированных с острым респираторным заболеванием». Возникающие инфекционные заболевания. 2004 г., 0 апр.; 10(4):700-5.

    15.02.2004
    Вайнберг Г.А., Эрдман Д.Д., Эдвардс К.М., Холл С.Б., Уокер Ф.Дж., Гриффин М.Р., Шварц Б., . «Превосходство полимеразной цепной реакции с обратной транскрипцией над обычной вирусной культурой в диагностике острых инфекций дыхательных путей у детей». Журнал инфекционных болезней. 2004 г., 15 февраля; 189(4):706-10.Epub 2004 Feb 04.

    01.02.2004
    Belshe RB, Newman FK, Tsai TF, Karron RA, Reisinger K, Roberton D, Marshall H, Schwartz R, King J, Henderson FW, Rodriguez W, Severs JM , Райт П.Ф., Кейзерлинг Х., Вайнберг Г.А., Бромберг К., Лох Р., Слай П., Макинтайр П., Зиглер Дж.Б., Хакелл Дж., Дитли А., Джорджиу А., Пасхалис М., Ву С.Л., Татем Дж.М., Мерфи Б., Андерсон Э. » Фаза 2 оценки живой аттенуированной вакцины против холодового пассажа 45 парагриппа типа 3 у здоровых детей в возрасте 6–18 месяцев». Журнал инфекционных болезней.. 2004 г., 1 февраля; 189(3):462-70. Epub 2004 20 января.

    9/2003
    Эрдман Д.Д., Вайнберг Г.А., Эдвардс К.М., Уокер Ф.Дж., Андерсон Б.К., Винтер Дж., Гонсалес М., Андерсон Л.Дж. «Анализ обратной транскрипции-ПЦР GeneScan для обнаружения шести распространенных респираторных вирусов у детей раннего возраста, госпитализированных с острым респираторным заболеванием». Журнал клинической микробиологии. 0 сентября 2003 г .; 41(9):4298-303.

    2003
    Мабанта К.Г., Прихубер Г.С., Вайнберг Г.А., Фелпс Д.Л. «Эритромицин для профилактики хронических заболеваний легких у интубированных недоношенных детей, подверженных риску, колонизированных или инфицированных Ureaplasma urealyticum.» Кокрановская база данных систематических обзоров. 2003 (4): CD003744.

    12/2002
    Шаффер С.Дж., Силаги П.Г., Шон Л.П., Амброуз С.Дж., Данн М.К., Барт Р.Д., Эдвардс К., Вайнберг Г.А., Балтер С. , Шварц Б. «Врачи перспективы пневмококковой конъюгированной вакцины.» Педиатрия.. 2002 0 декабря; 110 (6): e68.

    10/2002
    Weinberg GA. «Постконтактная профилактика инфекции вируса иммунодефицита человека после сексуального насилия. «Журнал детских инфекционных болезней.. 2002 0 октября; 21(10):959-60.

    9/2002
    Вайнберг Г.А. «Вопрос от клинициста: фаги при инфекциях». Педиатрия в обзоре. 0 сентября 2002 г .; 23(9):329-30.

    1/2002
    Чен С., Вайнберг Г.А. «Синдром острого некроза сетчатки у ребенка». Журнал детских инфекционных заболеваний. 0 января 2002 г .; 21(1):78-80.

    15.12.2001
    Вайнберг Г.А., Фриис Х., Бёларт Дж.Р., Вайнберг Э.Д. «Статус железа и тяжесть течения ВИЧ-инфекции у беременных.«Клинические инфекционные заболевания: официальная публикация Американского общества инфекционистов». 15 декабря 2001 г.; 33(12):2098-100.

    12/2001
    Вольф М., Ян Л., Ньюман Ф., Белше Р.Б., Ковач А., Девиль Дж.Г., Джелонек М., «Безопасность, выделение вакцинного вируса и иммуногенность трехвалентной, адаптированной к холоду, живой аттенуированной вакцины против гриппа, вводимой инфицированным и неинфицированным вирусом иммунодефицита человека». детей», «Детский инфекционный журнал».. 2001 г., 0 декабря; 20(12):1124-31.

    7/2001
    Джильотти Ф., Муранте Б.Л., Вайнберг Г.А. «Краткий курс терапии под непосредственным наблюдением для контроля соблюдения антиретровирусной терапии у детей, инфицированных вирусом иммунодефицита человека». Журнал детских инфекционных заболеваний. 0 июля 2001 г .; 20(7):716-8.

    5/2001
    Миллер Т.Л., Маун Б.Е., Орав Э.Дж., Уилк Д., Вайнберг Г.А., Никчитта Дж., Фурута Л., Кутрони Р., Макинтош К., Берчетт С.К., Горбач С.Л. «Влияние терапии ингибиторами протеазы на рост и состав тела у детей, инфицированных вирусом иммунодефицита человека 1 типа.«Педиатрия.. 2001 0 мая; 107(5):E77.

    4/2001
    Вайнберг Г.А. «Лабораторная диагностика эрлихиоза и бабезиоза». Журнал педиатрических инфекционных болезней.. 2001 0 апр; 20(4) :435-7.

    2001
    Миллер, Т.Л., Маун, Б.Э., Орав, Э.Дж., Уилк, Д., Вайнберг, Г.А., Никчитта, Дж., Фурута, Л., Кутрони, Р., Макинтош, К. .; Берчетт, С.К.; Горбач, С.Л.. «Влияние терапии ингибиторами протеазы на рост и состав тела у детей, инфицированных вирусом иммунодефицита человека типа 1».Педиатрия. 2001 г.; 107(5): Е77.

    2001
    Хаук М.Дж., Мосс М.Е., Вайнберг Г.А., Берковиц Р.Дж. «Задержка прорезывания зубов: связь с тяжестью ВИЧ-инфекции». Детская стоматология. 2001. 23(3):260-2.

    9/2000
    Вайнберг Г.А. «Дилемма постнатальной передачи ВИЧ от матери ребенку: кормить грудью или нет?» Рождение.. 2000 Сен 0; 27(3):199-205.

    25.01.2000
    Lee LH, Gigliotti F, Wright TW, Simpson-Haidaris PJ, Weinberg GA, Haidaris CG.«Молекулярная характеристика KEX1, кексиноподобной протеазы у мышей Pneumocystis carinii». Ген.. 2000 25 января; 242(1-2):141-50.

    2000
    Lee CH, Lasbury ME, Paulsrud JR, Bauer NL, Brady SL, Weinberg GA, Durant PJ, Bartlett MS, Smith JW. «Характеристика гена, кодирующего белок, богатый гистидином и аспарагиновой кислотой, из Pneumocystis carinii». Журнал эукариотической микробиологии. 2000 47(6):581-4.

    5/1998
    Уотсон В.Дж., Стивенс Т.П., Вайнберг Г.А.«Глубокая анемия у новорожденного от матери, получающей антиретровирусную терапию». Журнал детских инфекционных болезней. 1998 г. 0 мая; 17(5):435-6.

    11/1997
    Boelaert JR, Gordeuk VR, Piette J, Weinberg GA. «Отчет о конференции: международная конференция по ВИЧ и железу, Брюгге, 1997 г.». Тропическая медицина и международное здравоохранение: TM & IH .. 0 ноября 1997 г .; 2(11):1102-6.

    9/1997
    Вайнберг Г.А., Джильотти Ф., Стрончек Д.Ф., Эйбер Г., Кассманн Б., Муранте Б., Коронес Д.Н.«Отсутствие связи гранулоцитарных антител (антинейтрофильных антител) с нейтропенией у детей с инфекцией вирусом иммунодефицита человека». Журнал детских инфекционных заболеваний. 0 сентября 1997 г .; 16(9):881-4.

    1/1997
    O’Gara MJ, Lee CH, Weinberg GA, Nott JM, Queener SF. «Дегидрогеназа IMP из Pneumocystis carinii как потенциальная мишень для лекарств». Противомикробные препараты и химиотерапия. 0 января 1997 г .; 41(1):40-8.

    1997
    Хаук М., Берковиц Р.Дж., Мосс М., Мейеровиц С., Кассман Б., Вайнберг Г.А.«Госпитализации, связанные с поражением полости рта у перинатально ВИЧ-инфицированных детей». Детская стоматология. 1997 19(8):484-5.

    7/1996
    Вайнберг Г.А. «Перегрузка железом как механизм снижения выживаемости у больных СПИДом, получающих дапсон-протоксалат железа для вторичной профилактики пневмонии Pneumocystis carinii». Журнал инфекционных болезней. 1996 0 июля; 174(1):241-2.

    4/1996
    Boelaert JR, Piette J, Weinberg GA, Sappey C, Weinberg ED.«Железо и окислительный стресс как механизм усиленного производства вируса иммунодефицита человека альвеолярными макрофагами здоровых курильщиков сигарет». Журнал инфекционных болезней. 1996 0 апр.; 173(4):1045-7.

    1/1996
    Boelaert JR, Weinberg GA, Weinberg ED. «Измененный метаболизм железа при ВИЧ-инфекции: механизмы, возможные последствия и предложения по лечению». Инфекционные агенты и болезни. 0 января 1996 г .; 5(1):36-46.

    1995
    Вайнберг, Э.Д.; Вайнберг, Г.А.«Роль железа в инфекции». Curr Opin Infect Dis. 1995 год; 8: 164-169.

    5/1994
    Вайнберг Г.А. «Хелаторы железа как терапевтические средства против Pneumocystis carinii». Противомикробные препараты и химиотерапия. 1994 0 мая; 38(5):997-1003.

    1994
    Вайнберг Г.А.; Эдлинд, Т.Д.; Лу, Джей Джей; Ли, CH; Бауэр, Н.Л.; Дюрант, П.Дж.; «Генетическое разнообразие Pneumocystis carinii от разных видов-хозяев в локусе гена бета-тубулина и во внутренних транскрибируемых спейсерных областях кластера генов рРНК» .J.Eukaryot.Microbiol. 1994 год; 41(5): 118С.

    1994
    Вайнберг Г.А.; О’Гара, М.Дж.; Подушка, М.Т.;. «Коинфекция крыс генетически разнообразными формами Pneumocystis carinii, продемонстрированная полиморфизмом гена инозинмонофосфатдегидрогеназы P. carinii» . J.Eukaryot.Microbiol. 1994 год; 41(5): 119С.

    1994
    Вайнберг Г.А.; Дайкстра, CC; Дюрант, П.Дж.; Подушка, М.Т.;. «Хромосомная локализация 20 генов пяти различных кариотипических форм геля пульсирующего поля крыс Pneumocystis carinii» .J.Eukaryot.Microbiol. 1994 год; 41(5): 117С.

    1994
    Семинар по пневмоцистам (Стрингер, Дж. Р.; Бартлетт, М.; Кушон, М.Т.; Фишман, Дж. А.; Канеширо, Э. С.; Ли, С. Х.; Лейбовиц, М. Дж.; Лу, Дж. Дж.; Лундгрен, Б.; Питерс, SE; Smith, JW; Smulian, AG; Staben, C.; Stringer, SL; Wakefield, AE; Walzer, PD; Weinberg, GA). «Пересмотренная номенклатура Pneumocystis carinii». J.Eukaryotic Microbiol. 1994 год; 41: 121С-122С.

    1994
    Вайнберг Г.А., Дайкстра К.С., Дюрант П.Дж., Кушон М.Т.«Хромосомная локализация 20 генов пяти различных кариотипических форм геля пульсирующего поля крыс Pneumocystis carinii». Журнал эукариотической микробиологии.. 1994 41(5):117С.

    1994
    Вайнберг Г.А., Эдлинд Т.Д., Лу Дж.Дж., Ли Ч., Бауэр Н.Л., Дюрант П.Дж. «Генетическое разнообразие Pneumocystis carinii от разных видов-хозяев в локусе гена бета-тубулина и во внутренних транскрибируемых спейсерных областях кластера генов рРНК». Журнал эукариотической микробиологии.. 1994 41(5):118С.

    1994
    Вайнберг Г.А., О’Гара М.Дж., Кушон МТ. «Коинфекция крыс генетически разнообразными формами Pneumocystis carinii, продемонстрированная полиморфизмом гена инозинмонофосфатдегидрогеназы P. carinii». Журнал эукариотической микробиологии.. 1994 41(5):119С.

    1994
    Вайнберг Г.А., Дюрант П.Дж. «Генетическое разнообразие Pneumocystis carinii, полученное от инфицированных крыс, мышей, хорьков и клеточных культур». Журнал эукариотической микробиологии.. 1994 41(3):223-8.

    9/1993
    Клейман М.Д., Вайнберг Г.А., Рейнольдс Дж.К., Аллен С.Д. «Менингит с бета-лактам-резистентным Streptococcus pneumoniae: необходимость ранней повторной люмбальной пункции». Журнал детских инфекционных заболеваний. 0 сентября 1993 г ​​.; 12(9):782-4.

    11/1992
    Edlind TD, Bartlett MS, Weinberg GA, Prah GN, Smith JW. «Ген бета-тубулина из крысиных и человеческих изолятов Pneumocystis carinii». Молекулярная микробиология. 0 ноября 1992 г .; 6(22):3365-73.

    1991
    Вайнберг Г.А., Шоу М.М. «Подавляющее действие дефероксамина на рост Pneumocystis carinii in vitro». Журнал протозоологии. 1991 38(6):223S-224S.

    1991
    Вайнберг Г.А., Бартлетт М.С. «Сравнение кариотипов Pneumocystis carinii, полученных с помощью гель-электрофореза в импульсном поле, полученных из легких крысы, клеточной культуры и легких хорька». Журнал протозоологии. 1991 38(6):64S-65S.

    10/1990
    Вайнберг Г.А., Мерфи Т.В., Гранофф Д.М.«Конъюгированная вакцина против гемофильной палочки типа b полисахарид-дифтерийный анатоксин у вакцинированных детей, у которых развилась гемофильная болезнь». Педиатрия.. 1990 0 окт; 86(4):617-20.

    4/1990
    Вайнберг Г.А., Гранофф Д.М. «Иммуногенность конъюгированных полисахаридно-белковых вакцин Haemophilus influenzae типа b у детей с состояниями, связанными с нарушением реакции антител на полисахаридную вакцину типа b». Педиатрия.. 1990 0 апр.; 85 (4 часть 2): 654-61.

    1990
    Вайнберг Г.А., Леманн Д., Тупаси Т.Е., Гранофф Д.М.«Разнообразие профилей белков внешней мембраны нетипируемой Haemophilus influenzae у детей из Папуа-Новой Гвинеи и Филиппин». Обзоры инфекционных болезней. 1990 12 Приложение 8: S1017-20.

    1990
    Вайнберг Г.А., Спитцер Э.Д., Мюррей П.Р., Гафур А., Монтгомери Дж., Тупаси Т.Е., Гранофф Д.М. «Образцы чувствительности изолятов Haemophilus к противомикробным препаратам у детей в одиннадцати развивающихся странах. Исследовательская группа BOSTID Haemophilus Susceptibility Study Group». Бюллетень Всемирной организации здравоохранения.. 1990 68(2):179-84.

    10/1989
    Вайнберг Г.А., Гафур А., Исхак З., Номани Н.К., Кабир М., Анвар Ф., Берни М.И., Куреши А.В., Муссер Дж.М., Селандер Р.К. «Клональный анализ Hemophilus influenzae, выделенный от детей из Пакистана с инфекциями нижних дыхательных путей». Журнал инфекционных болезней. 1989 0 окт; 160(4):634-43.

    10/1988
    Вайнберг Г.А., Гранофф Д.М. «Полисахаридно-белковые конъюгированные вакцины для профилактики гемофильной инфекции типа b.«Журнал педиатрии». 0 октября 1988 г.; 113 (4): 621-31.

    9/1988
    Вайнберг Г.А., Таулер Д.А., Мансон Р.С. «Липопротеины гемофильной палочки типа b». Журнал бактериологии. 1988 Sep 0; 170(9):4161-4.

    8/1988
    Granoff DM, Weinberg GA, Shackelford PG «Ответ подкласса IgG на иммунизацию вакциной, конъюгированной с полисахаридом Haemophilus influenzae типа b и белком внешней мембраны. « Педиатрические исследования.. 0 августа 1988 г .; 24 (2): 180-5.

    7/1987
    Вайнберг Г.А., Эйнхорн М.С., Ленуар А.А., Гранофф П.Д., Гранофф Д.М.«Иммунологическая подготовка к капсульному полисахариду у младенцев, иммунизированных вакциной, конъюгированной с полисахаридом Haemophilus influenzae типа b и белком внешней мембраны Neisseria meningitidis». Журнал педиатрии. 1987 г., 0 июля; 111(1):22-7.

    09.08.1986
    Эйнхорн М.С., Вайнберг Г.А., Андерсон Э.Л., Гранофф П.Д., Гранофф Д.М. «Иммуногенность у младенцев полисахарида Haemophilus influenzae типа B в конъюгированной вакцине с белком внешней мембраны Neisseria meningitidis». Ланцет.. 1986 г., 9 августа; 2(8502):299-302.

    01.06.1986
    Вайнберг Г.А., Гранофф Д.М., Нахм М.Х., Шакелфорд П.Г. «Функциональная активность различных антител подкласса IgG против капсульного полисахарида типа b Haemophilus influenzae». Журнал иммунологии: официальный журнал Американской ассоциации иммунологов. 1 июня 1986 г .; 136(11):4232-6.

    6/1985
    Вайнберг Г.А., Шторх Г.А. «Подготовка образцов мочи для использования в коммерческих тестах латексной агглютинации на бактериальные антигены.Журнал клинической микробиологии. 1985 0 июня; 21(6):899-901.

    7/1983
    Вайнберг Г.А., Клейман М.Б., Гросфельд Дж.Л., Вебер Т.Р., Пшеница Л.Дж. «Необычные проявления гистоплазмоза в детском возрасте». .. Pediatrics.. 1983 Jul 0; 72(1):99-105.

    4/1983
    Failla ML, Craft NE, Weinberg GA. диабетическая крыса». Труды Общества экспериментальной биологии и медицины. 0 апреля 1983 г .; 172 (4): 445-8.

    Книги и главы

    2020
    Название главы: Вирусные заболевания парагриппа
    Название книги: Goldman’s Cecil Medicine, 26-е издание
    Список авторов: Weinberg G.A., Edwards K.M.
    Под редакцией: Goldman L., Schafer A.I.
    Опубликовано: Elsevier2020 в Филадельфии

    2020
    Название главы: Эпиглоттит
    Название книги: Mandell, Douglas and Bennett’s Principles and Practice of Infectious Diseases, 9th Edition
    Список авторов: Nayak JL, Weinberg GA.
    Под редакцией: Bennett JE, Dolin R, Blaser MJ.
    Опубликовано: Elsevier2020 в Филадельфии Издание
    Список авторов: Weinberg GA, Siberry GK
    Под редакцией: Bennett JE, Dolin R, Blaser MJ
    Опубликовано: Elsevier2020 в Филадельфии

    2019
    Название главы: Предотвращение инфекций и иммунизация
    Neonatology Review : Board Certification and Clinical Refreshing, 1st Edition
    Список авторов: Weinberg GA
    Под редакцией: Chess P.R.
    Опубликовано: Elsevier2019 в Филадельфии

    2019
    Название главы: Инфекции систем органов.
    Название книги: Обзор неонатологии Эйвери: Совет по сертификации и клиническому обновлению, 1-е издание
    Список авторов: Вайнберг Г.А.
    Под редакцией: Chess PR
    Опубликовано: Elsevier2019 в Филадельфии

    2019
    Название главы: Возбудители инфекций
    Название книги: Avery’s Neonatology Review: Board Certification and Clinical Refresher, 1st Edition.
    Список авторов: Weinberg GA
    Под редакцией: Chess PR
    Опубликовано: Elsevier2019 в Филадельфии

    2018
    Название главы: Инфекция вируса иммунодефицита человека (ВИЧ) у младенцев и детей
    Название книги: Руководство по диагностике и терапии Merck , 20-е издание
    Список авторов: Weinberg, GA
    Под редакцией: Porter RS, Kaplan JL
    Опубликовано: Merck & Co2018 in Kenilworth, NJ

    2018
    Название главы: Bacterial Infections of the Nervous System
    Books Title:
    Детская неврология: принципы и практика
    Список авторов: Weinberg GA, Stone, RT
    Под редакцией: Swaiman KF, Ashwal S, Ferriero DM, Schor NF, et al. : Различные инфекции у младенцев и детей (бактериальный менингит; скрытая бактериемия и лихорадка без видимого источника; инфекция мочевыводящих путей (ИМП) у детей; ревматическая лихорадка. )
    Название книги: Руководство Merck по диагностике и терапии, 20-е издание : комплексы неврологических симптомов
    Название книги: Принципы и практика детских инфекционных заболеваний, 5-е издание
    Список авторов: Weinberg GA
    Под редакцией: Long SS, Prober CG, Fishcer M
    Опубликовано: Elsevier Saunders 2018 в Филадельфии

    2016 2 Название главы: Эпиглоттит, ларингит, ларинготрахеит (бактериальный трахеит) и круп (ларинготрахеобронхит)
    Название книги: Инфекции верхних дыхательных путей
    Список авторов: Weinberg GA, Nayak J
    Под редакцией: Patel JA, Chonmaitree T
    Опубликовано: Future Sciences Group2016 в Лондоне

    2016
    Название главы: Лабораторные средства для диагностики неонатального сепсиса
    Название книги: Remington and Klein’sInfecti ous Diseases of the Fetus and Newborn Infant-8
    Список авторов: Weinberg GA, D’Angio CT
    Под редакцией: Wilson CB, Nizet V, Maldonado YA, Remington JS, Klein JO
    Опубликовано: Elsevier Saunders 2016 в Филадельфии

    2016
    Название главы: Лимфаденопатия
    Название книги: Учебник по педиатрии Американской академии педиатрии-2
    Список авторов: Вайнберг Г.А., Сегел Г.Б., Холл К.Б. DM, DeWitt TG
    Опубликовано: Американская академия педиатрии, 2016 г., Элк-Гроув-Виллидж, Иллинойс AM
    Под редакцией: McInerny TK, Adam HM, Cambell DE, Foy JM, Kamat DM, DeWitt TG
    Опубликовано: Американская академия педиатрии, 2016 г., Элк-Гроув-Виллидж, Иллинойс ases
    Название книги: Goldman’s Cecil Medicine-25
    Список авторов: Weinberg GA, Edwards KM
    Под редакцией: Goldman L, Schafer AI
    Опубликовано: Elsevier Saunders2015 в Филадельфии

    2015
    Название главы: Lymphadenopathy.
    Название книги: Признаки и симптомы в педиатрии
    Список авторов: Вайнберг Г.А., Сегель Г.Б., Холл С.Б.

    Название главы: Инфекция вируса иммунодефицита человека (ВИЧ) у младенцев и детей
    Название книги: Руководство Merck по диагностике и терапии-20
    Список авторов: Weinberg GA
    Под редакцией: Porter RS, Kaplan JL Co2015 in Whitehouse Station NJ

    2015
    Название главы: Детская инфекция, вызванная вирусом иммунодефицита человека (ВИЧ)
    Название книги: Mandell, Douglas and Bennett’s Principles and Practice of Infectious Diseases-8
    Список авторов: Weinberg GA, Siberry GK
    Edited Автор: Bennett JE, Dolin R, Blaser MJ
    Опубликовано: Elsevier Saunders 2015 в Филадельфии

    2015
    Название главы: Epiglottitis
    Название книги: Mandell, Douglas and Bennett’s Pri nciples and Practice of Infectious Diseases-8
    Список авторов: Nayak JL, Weinberg GA,
    Под редакцией: Bennett JE, Dolin R, Blaser MJ
    Опубликовано: Elsevier Saunders2015 in Philadelphia

    2012 926inza Название главы: Parafluenza Diseases .
    Название книги: Учебник медицины Сесила
    Список авторов: Вайнберг Г.А., Эдвардс К.М.
    Под редакцией: Голдман Л., Шафер А.И. Long SS, Pickering LK, Prober CG
    Опубликовано: Elsevier Saunders2012 в Филадельфии

    2011
    Название главы: Инфекция вируса иммунодефицита человека (ВИЧ) у младенцев и детей.
    Название книги: Руководство Merck по диагностике и терапии
    Список авторов: Weinberg GA.
    Под редакцией: Porter RS, Kaplan, JL
    Опубликовано: Merck & Co., Inc., 2011 г., Whitehouse Station, NJ

    2011
    Название главы: Лабораторные средства для диагностики неонатального сепсиса
    Название книги: Infectious Diseases of the Fetus и Newborn Infant-7
    Список авторов: Weinberg GA, D’Angio CT
    Под редакцией: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA
    Опубликовано: Elsevier Saunders2011 in Philadelphia

    2011

    Chapter

    2 Title : Различные инфекции у младенцев и детей.
    Название книги: Руководство Merck по диагностике и терапии
    Список авторов: Weinberg GA.
    Под редакцией: Porter RS, Kaplan, JL
    Опубликовано: Merck & Co., Inc., 2011 г., Whitehouse Station, NJ

    2010
    Название главы: Детская инфекция, вызванная вирусом иммунодефицита человека (ВИЧ)
    Название книги: Mandell, Douglas and Bennett’s Principles and Practice of Infectious Diseases-7
    Список авторов: Weinberg GA, Siberry GK
    Под редакцией: Mandell GL, Bennett JE, Dolin R
    Опубликовано: Churchill Livingstone Elsevier2010 in Philadelphia

    2009

    1 Глава 92 Название: Бактериальные инфекции у детей..
    Название книги: Руководство Merck по домашнему здравоохранению.
    Список авторов: Вайнберг Г.А.
    Под редакцией: Porter RS, Kaplan JL, Homeier BP
    Опубликовано: Merck & Co., Inc., 2009 г., Whitehouse Station, NJ

    2009
    Название главы: Meningitis
    Название книги: American Academy of Pediatrics Textbook of Pediatric Care
    Список авторов: Weinberg GA, Buchanan A
    Под редакцией: McInerny TK, Adam HM, Cambell DE, Kamat DM, Kelleher KJ
    Опубликовано: American Academy of Pediatrics 2009 в Elk Grove Village, IL

    2008
    Название главы: Neurologic комплексы симптомов
    Название книги: Принципы и практика детских инфекционных болезней, 3-е изд.
    Список авторов: Weinberg GA, Moran MM
    Под редакцией: Long SS, Pickering LK, Prober CG
    Опубликовано: Elsevier2008 в Филадельфии, Пенсильвания

    2008
    протозойные и гельминтозы легких).
    Название книги: Детская респираторная медицина, 2-е изд.
    Список авторов: Weinberg GA, Buchanan AM
    Отредактировано: Taussig LM, Landau LI, LeSouef PN, Martinez FD, Morgan WJ, Sly PD и ВИЧ-инфекция
    Название книги: Педиатрический клинический консультант: немедленная диагностика и лечение, 2-е изд.
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski JM, Christy C
    Опубликовано: Mosby Elsevier2007 в Philadelphia, PA

    2007
    Лечение, 2-е изд.
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski JM, Christy C
    Опубликовано: Mosby Elsevier2007 в Филадельфии, Пенсильвания

    2007
    Название главы: Rocky Mountain Spotted Disease
    Диагностика и лечение, 2-е изд.
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski JM, Christy C
    Опубликовано: Mosby Elsevier2007 в Филадельфии, Пенсильвания

    2007
    Название главы: Yersiniagnosis Clinical Pecocolitica Book:
    Лечение, 2-е изд.
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski JM, Christy C
    Опубликовано: Mosby Elsevier 2007 in Philadelphia, PA

    2006
    Название главы: Лабораторные средства для диагностики неонатального сепсиса Название: 62 Infectious Diseases Book 92 плода и новорожденного, 6-е изд.
    Список авторов: Weinberg GA, D’Angio CT
    Под редакцией: Remington JS, Klein JO, Wilson CB, Baker CJ
    Опубликовано: Elsevier Saunders 2006 in Philadelphia, PA

    2006
    Глава 92 Инфекции младенцев и детей3 Название книги: Руководство Merck по диагностике и терапии, 18-е изд.
    Список авторов: Weinberg GA
    Под редакцией: Beers MH, Porter RS, Jones TV, Kaplan JL, Berkwits M
    Опубликовано: Merck & Co., Inc., 2006 г., Whitehouse Station, NJ

    2005
    Название главы: Детская инфекция вируса иммунодефицита человека (ВИЧ)
    Название книги: Mandell, Douglas & Bennett’s Principles & Practice of Infectious Diseases, 6th E
    Список авторов: Weinberg GA, Burchett SL
    Под редакцией: Mandell GL, Bennett JE, Dolin R
    Опубликовано : Elsevier2005 in Philadelphia, PA

    2003
    Название главы: Бактериальные инфекции у детей
    Название книги: The Merck Manual of Medical Information — 2nd Home Edition
    Список авторов: Weinberg GA
    Под редакцией: Beers MH
    Издатель: и Ко., Inc.2003 in Whitehouse Station, NJ

    2003
    Название главы: Антиретровирусная терапия
    Название книги: Риз и Беттс. Практический подход к инфекционным заболеваниям, 5-е изд.
    Список авторов: Luque AE, Cohn SE, Weinberg GA, Mariuz P.
    Под редакцией: Betts RF, Chapman SW, Penn RL ВИЧ-инфекция
    Название книги: Mosby’s Pediatric Clinical Advisor: Instant Diagnosis and Treatment
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski J, Christy C.2002 in St. Louis, MO

    2002
    Название главы: Listeria monocytogenes
    Название книги: Mosby’s Pediatric Clinical Advisor: Instant Diagnosis and Treatment
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski 9 J, 63 Опубликовано: Mosby, Inc.2002 в Сент-Луисе, Миссури

    2002
    Название главы: Пятнистая лихорадка Скалистых гор
    Название книги: Mosby’s Pediatric Clinical Advisor: Instant Diagnosis and Treatment
    Список авторов: Weinberg GA
    Под редакцией: Garfunkel LC, Kaczorowski J, Christy C
    Опубликовано: Mosby, Inc.2002 in St. Louis, MO

    2002
    Название главы: Yersinia enterocolitica
    Название книги: Mosby’s Pediatric Clinical Advisor: Instant Diagnosis and Treatment
    Список авторов: Weinberg GA
    Под редакцией: LC, Kaczorowski 9 J, 632 Christy C Автор: Mosby, Inc.2002 in St. Louis, MO

    2002
    Название главы: Железо и ВИЧ-инфекция
    Название книги: Микронутриенты и ВИЧ-инфекция
    Список авторов: Weinberg GA, Boelaert JR, Weinberg ED
    Под редакцией: Friis H
    Опубликовано: CRC Press, Inc.2002 г. в Бока-Ратон, Флорида

    2001
    Название главы: Гистоплазмоз
    Название книги: Сущность офисной педиатрии
    Список авторов: Вайнберг Г.А.
    Под редакцией: Стокман Дж.А. PA

    2001
    Название главы: Лабораторные средства для диагностики неонатального сепсиса
    Название книги: Инфекционные болезни плода и новорожденного, 5-е изд.
    Список авторов: Вайнберг Г.А., Пауэлл К.Р.
    Под редакцией: Ремингтон Дж.С., Кляйн Дж.О.
    Список авторов: Weinberg GA
    Под редакцией: Hoekelman RA, Weitzman ML, Adam HM, Nelson NM, Wilson MH
    Опубликовано: Mosby, Inc.2001 in St. инфекция вируса иммунодефицита (ВИЧ)
    Название книги: Mandell, Douglas & Bennett’s Principles & Practice of Infectious Diseases, 5th E
    Список авторов: Weinberg GA
    Под редакцией: Mandell GL, Bennett JE, Dolin R
    Опубликовано: Churchill Livingstone 2000 в Филадельфии , PA

    1999
    Название главы: Pneumocystis carinii pneumonitis
    Название книги: Gellis and Kagan’s Current Pediatric Therapy, 16th Ed.
    Список авторов: Gigliotti F, Weinberg GA
    Под редакцией: Burg FD, Ingelfinger JR, Polin RA, Wald ER , Legionella pneumophila, а также протозойные и гельминтозные легочные инфекции)
    Название книги: Pediatric Respiratory Medicine
    Список авторов: Weinberg GA, Rathore MH, White AC Jr.
    Под редакцией: Taussig LM and Landau LI
    Издано: Mosby, Inc.1999 г. в Сент-Луисе, Миссури

    1999
    Название главы: Инфекция вируса иммунодефицита человека (ВИЧ) у детей
    Название книги: Руководство Merck по диагностике и терапии — Centennial (17th) Ed.
    Список авторов: Weinberg GA
    Под редакцией: Beers MH и Berkow R
    Издатель: Merck & Co., Inc., 1999 г., Whitehouse Station, NJ

    1999
    Название главы: Различные инфекции: синдром Рея
    Название книги: Руководство Merck по диагностике и терапии — Centennial (17th) Ed.
    Список авторов: Weinberg GA
    Под редакцией: Beers MH и Berkow R
    Издано: Merck & Co., Inc., 1999 г., Whitehouse Station, NJ

    1999
    Название главы: Различные инфекции: лихорадка неизвестного происхождения
    Книга Название: Руководство Merck по диагностике и терапии — Centennial (17th) Ed.
    Список авторов: Weinberg GA. Руководство Merck по диагностике и терапии — Centennial (17th) Ed.
    Список авторов: Weinberg GA. The Merck Manual of Medical Information — Home Edition
    Список авторов: Weinberg GA
    Под редакцией: Berkow R
    Опубликовано: Merck & Co., Inc., 1998 г., Whitehouse Station, NJ

    1998
    Название главы: Вероятно вызванные расстройства инфекцией (педиатрическая)
    Название книги: The Merck Manual of Medical Information — Home Edition
    Список авторов: Weinberg GA
    Под редакцией: Berkow R
    Издатель: Merck & Co., Inc.1998 in Whitehouse Station, NJ

    1998
    Название главы: Вирус иммунодефицита человека (ВИЧ) у детей
    Название книги: The Merck Manual of Medical Information — Home Edition
    Список авторов: Weinberg GA
    Под редакцией: Berkow R
    Опубликовано: Merck & Co.

    Добавить комментарий

    Ваш адрес email не будет опубликован.

    RSV Positive N = 75 (%) RSV отрицательный N = 30 (%) P -Value
    0 место доставки
    Больница 64 (71) 26 (29) 26 (29) 0. 86
    11 (74) 4 (26)

    9
    Доставка
    FTP 71 (72) 27 (28) 0.386
    преданности 4 (57) 3 (43) 3 (43)
    клинических проявлений 9170 Лихорадка (> 38 ° C) 69 (72) 27 (28) 0. 741
    кашель 74 (71) 30 (29) 30 (29) 0.525
    Hheezing 70 (72) 27 (28) 0.229
    Сложное дыхание 55 (72) 21 (28) 0,9319
    Курение 73 (79) 19 (21) 0.172
    Тип пациента

    60 (70) 60 (30) 26 (30) 0. 423
    Стационарные
    15 (79) 4 (21)
    Окончательный диагноз
    Бронхиолит 31 (76) 9 0,124152
    34 (64) 19 (36) 19 (36) 19 (36)
    Диагноз недовелобился 1 (9) 10 (91)

    Таблица 3. Клинико и эпидемиологические характеристики между положительными и отрицательными случаями RSV.

    Филогенетический анализ и анализ аминокислотной последовательности G-белка

    Из 75 штаммов РСВ, выявленных у детей с ОРИ, семьдесят один был подтипом РСВ-А и четыре — РСВ-В соответственно.Филогенетический анализ нуклеотидной и аминокислотной последовательностей HVR2 показал, что все проанализированные штаммы RSV-A принадлежали к генотипу GA2, кластеризующемуся с субгенотипом NA1. Гомология нуклеотидов и аминокислот среди штаммов варьировалась от 95,8 до 100% и от 97 до 100% соответственно (рис. 2а). Степень расхождения между штаммом-прототипом А2 и штаммами группы А Pak Gilgit (PG) составляла от 12,7% до 13,9% и от 12% до 14% на уровне нуклеотидов и аа соответственно. По сравнению со штаммом A2 G-белок PG RSV-A кодирует 297 аминокислот.При сравнении с эталонным штаммом A2 специфические аминокислотные замены для генотипа GA2 были идентифицированы среди вирусов PG RSV-A, включая; S222P, P226L, E233K, N237D, I244R, L258H, M262E, F265L, S269T, S280Y, P283S, P286L, P289S, S290P/L, P292S, P293S, P296T и R297K. PG RSV-A в вирусах сформировали два субкластера; три вируса сгруппированы со штаммом ON-160-0111 A (Канада), в то время как другие сгруппированы со штаммами Niigata (Япония) и Chongqing (Китай) со значениями начальной загрузки > 70%. Замена P256L отсутствовала в пакистанских штаммах, в то время как в положении 290 два образца сохранили остаток серина; два штамма имели пролин, в то время как только PAK GB/57/2012 имел классическую замену S290L (рис. 3а).

    Рис. 2. Филогенетическое древо второй вариабельной области генотипов и подтипов РСВ групп А и В.

    Штаммы-прототипы A2 и 18537 использовались в качестве исходных групп в анализе. Эти деревья были построены с использованием алгоритма объединения соседей с 1000 бутстраповскими репликами с использованием MEGA 5. Генотипы указаны скобками справа. В узлах ветвления отображаются только значения начальной загрузки более 50%.

    https://doi.org/10.1371/journal.pone.0074018.g002

    Рис. 3. Расчетное выравнивание аминокислот второй вариабельной области гена G-белка штаммов RSV-A (a) и RSV-B (b) RSV-PG.

    Выравнивания показаны относительно последовательностей штамма-прототипа A2 (инвентарный номер GenBank M11486) и штамма BA4128/99B генотипа BA (инвентарный номер GenBank AY333364). Нумерация аминокислот соответствует положениям 220-298 белка G штамма A2 для вирусов HRSV-A и положениям 219-315 белка G штамма BA4128/99B для вирусов HRSV-B.Идентичные остатки обозначены точками. Стоп-кодоны обозначены звездочками. Потенциальные сайты N-гликозилирования (NXT, где X не является пролином) обозначены заштрихованными блоками. На панели b две копии дуплицированной области из 20 аминокислот в вирусах HRSV-B обозначены прямоугольниками.

    https://doi.org/10.1371/journal.pone.0074018.g003

    Все штаммы Pak Gilgit RSV подгруппы B сгруппированы в недавно идентифицированный генотип BA (рис. 2b). Штаммы Pak Gilgit RSV B имеют общий 91.Идентичность нуклеотидов от 8 до 100% и идентичность аминокислот от 98,6 до 100%. Между штаммами группы В PG и штаммом прототипного генотипа В Ch28537 наблюдалось расхождение от 62% до 70% на уровне нуклеотидов и расхождение от 25% до 29,2% на уровне аминокислот. Выведенные аминокислотные последовательности всех штаммов PG BA, наблюдаемых в этом исследовании, имели предсказанную длину 319 а.о. из-за дупликации 20 аминокислот. Кроме того, во всех штаммах PG RSV-B также наблюдалась делеция шести нуклеотидов после остатка 489, что приводило к делеции 2 аминокислот (данные последовательности не показаны).Другие аминокислотные мутации наблюдались в следующих положениях по сравнению со штаммом-прототипом; K218T, Q248R, T270I, V271A, h387Y (рис. 3б).

    Анализ сайтов N и O-гликозилирования

    Отличительные паттерны предполагаемых сайтов O- и N-гликозилирования были обнаружены среди изолятов PG. Только два предполагаемых сайта N-гликозилирования были идентифицированы во второй вариабельной области белка G среди штаммов PG RSV-A. Оба N-гликозилированных сайта имели код NTT в аминокислотных положениях 251 и 294 и были консервативными, как штаммы-прототипы A2 и NA1/GA2.Профиль O-гликозилирования был сходным при анализе 131 аминокислоты для G-белка PG RSV-A и предсказывал, что до 39 участков серина и треонина будут O-гликозилированы с показателем G 0,5-0,7. Кроме того, среди всех проанализированных штаммов PG RSV-A, как сообщается, консервативные положения серина в 267, 270, 275, 283, 287 и треонина в 227, 231, 235, 253 и 282 с высокой вероятностью O-гликозилирования были сохранились (рис. 3а).

    Два сайта N-гликозилирования были идентифицированы среди штаммов группы B (рис. 3b) в положениях 296 и 310 аа на С-конце гена белка G, которые консервативны почти у всех штаммов B.Анализ сайтов О-гликозилирования 254 аминокислот предсказал наличие до 64 потенциальных сайтов для присоединения О-связанных сахаров к остаткам серина и треонина в эктодомене белка прикрепления HRSV-BG (оценка G 0,5-0,7).

    В дополнение к остаткам серина и треонина в последовательностях белка RSV-A присутствовал мотив KPX n TTKX n (рис. 3а), который связан с экстенсивным O-гликозилированием белка G. Этот мотив не был идентифицирован среди группы штаммы В.

    Обсуждение

    РСВ представляет собой серьезное бремя острых заболеваний дыхательных путей, особенно в первые годы жизни, что приводит к тяжелой заболеваемости и госпитализации у очень маленьких детей [9,16,26]. Знание молекулярной эпидемиологии RSV в основном основано на исследованиях, проведенных в развитых странах [10,34,35]. Наши результаты показывают, что RSV является важным вирусным респираторным патогеном, способствующим заболеваемости и смертности, особенно среди очень маленьких детей в Пакистане.В этом исследовании мы проанализировали последовательности G-белка изолятов RSV-A и B из клинических образцов зимой 2011–2012 годов в провинции Гилгит-Балтистан в Пакистане. За трехмесячный период у детей с ОРЗ было взято более 100 образцов, при этом наблюдался значительно высокий уровень инфицирования РСВ (71,4%). Инфекции RSV достигли пиковых уровней в середине февраля и постепенно пошли на убыль к концу марта.

    Поскольку больница DHQ Гилгит является больницей третичного уровня, которая обслуживает самых разных пациентов, образцы, которые были собраны для этого исследования, представляют собой лишь часть детей с ОРЗ.На основании необычно большого числа положительных случаев РСВ в этом изолированном регионе мы делаем вывод, что на самом деле это была сезонная вспышка РСВ. В других исследованиях аналогичным образом сообщалось о периодах интенсивных/высоких уровней инфекций/эпидемий РСВ в определенные периоды года [13,17,21,36,37]. Дальнейшее наблюдение за распространенностью и сезонностью РСВ может помочь выяснить бремя болезни в этом регионе.

    Предыдущие исследования показывают, что дети мужского пола более восприимчивы к тяжелым заболеваниям, чем девочки [12,19,21,35].Аналогичные результаты были получены в нашем исследовании, и более высокий процент инфицированных РСВ детей (55% n=39/71) был мужского пола, статистический анализ клинических особенностей и частоты госпитализаций между пациентами мужского и женского пола не выявил каких-либо существенных различий. Анализ возрастного распределения наших пациентов с РСВ-инфекцией показал, что дети младше шести месяцев имели самые высокие показатели инфицирования. В различных исследованиях сообщается о наибольшей частоте РСВ-ассоциированных ЛРИ в развивающихся странах у младенцев в возрасте до шести месяцев, и примерно две трети РСВ-ЛРИ встречаются у детей в возрасте до двух лет (8,29). В нашем исследовании, хотя число инфицированных РСВ у амбулаторных больных (n=60) было выше, чем у стационарных больных (n=15), частота инфицирования РСВ у амбулаторных больных (69,8%, 60/86) была ниже, чем у госпитализированных (78,9%, 15/19). Поэтому мы повторяем, что раннее тестирование на РСВ у младенцев с ОРИ должно быть приоритетным для обеспечения надлежащего лечения. Кроме того, согласно нашим данным, бронхиолит и бронхопневмония были наиболее частыми клиническими диагнозами у РСВ-положительных случаев, как сообщалось ранее (12-14, 37,38), при этом РСВ, как считается, составляет примерно 85% случаев бронхиолита и примерно 20 % случаев детской пневмонии.

    Настоящее исследование проводилось только в одной больнице, куда дети из близлежащих и отдаленных районов могут постоянно обращаться в течение многих лет. Образцы были взяты в основном у детей в возрасте до 2 лет с острыми симптомами со стороны верхних и нижних дыхательных путей, такими как свистящее дыхание, кашель, ринорея и лихорадка. Хорошо известно, что при повторном заражении наблюдается снижение тяжести клинического заболевания [14,15,38]. Поскольку у нас нет предыдущих данных о РСВ-инфекциях в регионе и нам не удалось получить баллы по шкале тяжести заболевания, мы не можем обсуждать различия в клинической картине применительно к каким-либо повторным инфекциям.Кроме того, ограничение исследования заключается в том, что существует вероятность пропуска случаев из-за отсутствия обращения в клинику из-за слабовыраженных симптомов и значительных расстояний между селами и больницами. Хотя информация о госпитализации была доступна, количество амбулаторных больных было большим по сравнению с госпитализированными, и не удалось установить значимых связей между подтипом/генотипом и тяжестью заболевания.

    В этом исследовании было обнаружено большее количество вирусов RSV группы A по сравнению со штаммами группы B.Предыдущие исследования [4, 12, 15, 28] также зафиксировали преобладающую глобальную распространенность подтипа RSV A, предположительно, из-за их более высокого уровня генетической изменчивости и дивергенции. Ограниченная изменчивость среди вирусов группы B может способствовать более длительному распространению этих вирусов, что приводит к преобладанию вирусов группы A над вирусами группы B во многих исследованиях эпидемиологии РСВ. В то же время также установлен факт, что различные подтипы и генотипы РСВ могут коциркулировать в течение одного сезона, а преобладающий подтип может меняться от года к году [3,11,12,15,17,29,36,39].На основании наших ограниченных данных мы не можем в настоящее время сравнить характер распространения RSVA и подтипов B, но текущие данные эпиднадзора смогут лучше прояснить преобладающий образец.

    Последовательности HVR2 белка G вирусов RSV-A были только на 94-97% гомологичны последовательностям, зарегистрированным в соседних странах, включая Китай и Индию, и в GenBank не удалось найти идентичных последовательностей. Это понятно, поскольку в настоящее время доступны ограниченные данные о последовательности распространенности RSV в Юго-Восточной Азии и восточном Средиземноморье [10,40,51]. Напротив, также известно, что вирусы из разных регионов и разных сезонов могут быть более похожими, чем вирусы, выделенные из одного и того же района в течение одного сезона [8, 25, 30, 41-43].

    Было обнаружено, что G-белок всех проанализированных штаммов RSV-A имеет длину 297 аминокислот, в отличие от эталонного штамма A2, который имеет длину 298 а.о. Другие исследования из соседних Индии и Китая также показали преобладание подтипа GA2 для вирусов RSV-A с различной длиной G-белка [8, 43, 44]. Наши данные свидетельствуют о том, что штаммы RSVA, недавно циркулирующие в регионе Гилгит, сгруппированы с генотипом NA1/GA2 (значение начальной загрузки 92%), которые возникли в Восточной Азии и распространились по всему миру [45].Наши вирусы RSV, безусловно, ближе к ранее описанным вирусам Niigata NA1 из Японии по сравнению с группой ON1 подтипов NA1 [12]. Кроме того, среди секвенированных штаммов PG RSV-A не наблюдалось никаких новых ON1-специфических замен в E232G T253K, N273Y и P274L (рис. 3а). Однако из-за отсутствия данных о генотипировании за последние годы в Пакистане мы не можем ни подтвердить какие-либо конкретные закономерности внедрения/миграции вируса, ни оценить темпы эволюции этих изолятов.

    Мы впервые сообщаем о пакистанских штаммах группы B, принадлежащих к недавно идентифицированному генотипу BA, с характерной 60-нуклеотидной дупликацией в HVR2 белка G, впервые выделенного в 1999 г. в Буэнос-Айресе, Аргентина [34]. Впоследствии генотип БА был обнаружен в Японии в 2003 г. [44], затем в Китае [41], Таиланде [37,46,47], Южной Африке [9], Бразилии [52] и Индии [8], став преобладающим ВПЧ-вирусом. Генотип B циркулирует по всему миру. Все штаммы группы B несут характерную 60-нуклеотидную дупликацию, консервативные стоп-кодоны и шестинуклеотидную делецию в HVR1 [13,30,41,48].Предыдущие исследования сообщали о различной длине G-белка для вирусов RSV B, выделенных в течение того же сезона [5, 30, 41, 49]. Однако среди штаммов PG RSV B предполагаемая гомология аминокислот в HRV2 составляла от 98 до 100%, и наблюдался только один G-белок длиной 319 а. о. Кроме того, аминокислотная замена S247P, наблюдаемая в дуплицированной области из 20 аминокислот, также отсутствовала в вирусах Gilgit RSV B, что сближает их с ранее описанным штаммом-прототипом BA. Эти изоляты RSV-B также несут шестинуклеотидную делецию после внутрирамочной делеции остатка 489 (аминокислотные позиции 159-160), о которой ранее сообщалось в китайских штаммах из Чунцина и в других исследованиях [15,41].Несмотря на то, что количество вирусов RSV-B, проанализированных в этом исследовании, слишком мало, ожидается, что будущий анализ пакистанских штаммов поможет понять значение этих мутаций с большим количеством изолятов RSV-B из последовательных сезонов.

    N- и O-связанные сайты гликозилирования могут влиять на экспрессию определенных эпитопов, либо маскируя, либо способствуя распознаванию углевод-специфическими антителами, и помогают вирусам избежать иммунного ответа хозяина [50].Поскольку G-белок сильно гликозилирован из-за высокого содержания серина и треонина, возможно, что иммунологическое влияние аминокислотных различий между штаммами усиливается за счет изменений, происходящих в сайтах гликозилирования [33]. Оба штамма PG группы A и B имели по 2 сайта N-гликозилирования каждый во второй вариабельной области G-белка (рис. 3). В случае вирусов PG RSV-A сайты N-гликозилирования зарегистрированы в положениях 237 и 250 аа, что является особенностью, описанной в подлинии NA1 японских (Niigata) штаммов из-за замены N237D [44,45].Кроме того, мы идентифицировали только девять позиций остатков серина и треонина, которые потенциально могут быть O-гликозилированы в 60-нуклеотидной дуплицированной области RSV-B, в то время как в большинстве исследований сообщается до 10 потенциальных сайтов (рис. 3b; позиции №; 264–267, 269). , 270, 274–276 и 280) [43]. Было высказано предположение, что изменение количества и расположения сайтов гликозилирования может привести к постоянной циркуляции определенных генотипов, поскольку вирусы избегают нейтрализации уже существующими антителами. Было показано, что белок гемагглютинин обеспечивает селективное преимущество для вирусов гриппа за счет образования более устойчивого к нейтрализации вирусного потомства.

    Это первый подробный отчет, содержащий важные предварительные данные о молекулярной эпидемиологии ОРИ, ассоциированного с РСВ, в Пакистане. В нем подчеркивается значимость РСВ как доминирующего вирусного этиологического агента ОРИ у детей и необходимость дальнейшей работы по изучению заболеваемости вирусными пневмониями и их влиянию на здоровье населения. Установлено, что различные факторы, такие как преобладающие погодные и климатические факторы, статус ранее существовавшего штаммоспецифического иммунитета к вирусу в сообществе, будут определять, какие штаммы (присутствующие эндемично в сообществе или занесенные извне) будут преобладать в последующем. сезоны.Таким образом, нельзя переоценить важность долгосрочных молекулярно-эпидемиологических исследований для раннего выявления распространенных штаммов и новых генотипов, которые способствуют лучшему пониманию инфекций РСВ в различных регионах Пакистана.

    Благодарности

    Мы благодарим за техническую поддержку наших сотрудников из Отделения респираторных вирусов Центров по контролю и профилактике заболеваний. Мы подтверждаем образцы пациентов, отправленные консультантом по педиатрии докторомРафи из DHQ Hospital Gilgit для этого исследования. Кроме того, мы благодарим г-на Ясира Аршада и г-жу Асию Исрар за их техническую поддержку в завершении лабораторных испытаний, г-на Аднана Хуршида за секвенирование и г-жу Надию Нисар за анализ данных.

    Авторские взносы

    Задумал и спроектировал эксперименты: SSZZ. Провел эксперименты: UBA MMA. Проанализированы данные: UBA HS. Предоставленные реагенты/материалы/инструменты для анализа: SSZZ. Написал рукопись: УБА ССЗЗ. Рецензировал рукопись: BMK.

    Каталожные номера

    1. 1. Anderson LJ, Hierholzer JC, Hendry RM, Fernie BF, Stone Y et al. (1985) Антигенная характеристика штаммов респираторно-синцитиального вируса с моноклональными антителами. J Infect Dis 151: 626–633. doi: https://doi.org/10.1093/infdis/151.4.626. PubMed: 2579169.
    2. 2. Ботоссо В.Ф., Занотто П.М., Уэда М., Арруда Э., Гилио А. Е. и соавт. (2009) Положительный отбор приводит к частым обратимым заменам аминокислот в гене G-белка респираторно-синцитиального вируса человека.ПЛОС Патог 5:e1000254.
    3. 3. Cane PA, Pringle CR (1995)Эволюция респираторно-синцитиального вируса подгруппы А: свидетельство прогрессивного накопления изменений аминокислот в белке прикрепления. Дж. Вирол 69: 2918–2925. PubMed: 7707517.
    4. 4. Кейн П.А., Мэтьюз Д.А., Прингл К.Р. (1994) Анализ вариаций штаммов респираторно-синцитиального вируса при последовательных эпидемиях в одном городе. J Clin Microbiol 32: 1–4. PubMed: 8126162.
    5. 5. Queiróz DAO, Durigon EL, Botosso VF, Ejzemberg B, Vieira SE et al.(2002)Иммунный ответ на респираторно-синцитиальный вирус у маленьких бразильских детей. Braz J Med Biol Res 35: 1183-1193. PubMed: 12424491.
    6. 6. Гафур А., Номани Н.К., Исхак З., Заиди С.З., Анвар Ф. и др. (1990) Диагностика острых инфекций нижних дыхательных путей у детей в Равалпинди и Исламабаде, Пакистан. Rev Infect Dis 12 (дополнение 8): S907-S914. doi: https://doi.org/10.1093/cliniids/12.Supplement_8.S907. PubMed: 2270413.
    7. 7. Henderson FW, Collier AM, Clyde WJ, Denny FW (1979) Респираторно-синцитиальные вирусные инфекции, повторные инфекции и иммунитет.Проспективное лонгитюдное исследование у детей раннего возраста. N Engl J Med 300: 530–534. doi: https://doi.org/10.1056/NEJM197
    75.
  • 36. Хендри Р.М., Талис А.Л., Годфри Э., Андерсон Л.Дж., Ферни Б.Ф. и другие. (1986) Параллельная циркуляция антигенно различных штаммов респираторно-синцитиального вируса во время вспышек среди населения. J Infect Dis 153: 291–297. doi: https://doi.org/10.1093/infdis/153.2.291. PubMed: 2418126.
  • 37. Фрай А.М., Читтаганпитч М., Баггетт Х.К., Перет Т.С., Дэйр Р.К. и др. (2010) Бремя госпитализированной инфекции нижних дыхательных путей из-за респираторно-синцитиального вируса в сельской местности Таиланда.ПЛОС ОДИН 5: e15098. doi: https://doi.org/10.1371/journal.pone.0015098. PubMed: 21152047.
  • 38. Наир Х., Нокес Д.Д., Гесснер Б.Д., Дхерани М., Мадхи С.А. и другие. (2010)Глобальное бремя острых инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом у детей раннего возраста: систематический обзор и метаанализ. Ланцет 375: 1545–1555. doi: https://doi.org/10.1016/S0140-6736(10)60206-1. PubMed: 20399493.
  • 39. Woelk CH, Holmes EC (2001)Вариабельный иммунный естественный отбор в прикреплении (G) гликопротеина респираторно-синцитиального вируса (RSV).Дж. Мол Эвол 52: 182–192. PubMed: 11231898.
  • 40. Wardlaw TM, Johansson EW, Hodge M (2006) Пневмония: забытый убийца детей. Детский фонд ООН (ЮНИСЕФ). Всемирная организация здравоохранения (ВОЗ). Доступно: http://www.who.int/child_adolescent_health.
  • 41. Чжан Р.Ф., Джин И., Се З.П., Лю Н., Ян К.Л. и др. (2010) Респираторно-синцитиальный вирус человека у детей с острыми инфекциями дыхательных путей в Китае. J Clin Microbiol 48: 4193–4199. дои: https://дои.орг/10.1128/JCM.00179-10. PubMed: 20810776.
  • 42. Златева К.Т., Лемей П., Вандамм А.М., Ван Ранст М. (2004)Молекулярная эволюция и модели циркуляции подгруппы А респираторно-синцитиального вируса человека: положительно выбранные сайты в гликопротеине G прикрепления. Дж. Вирол 78: 4675–4683. doi: https://doi.org/10.1128/JVI.78.9.4675-4683.2004. PubMed: 15078950.
  • 43. Златева К.Т., Вийген Л., Декеерсмакер Н., Наранхо С., Ван Ранст М. (2007)Распространенность подгрупп и модели циркуляции генотипа респираторно-синцитиального вируса человека в Бельгии в течение десяти последовательных эпидемических сезонов.J Clin Microbiol 45: 3022–3030. doi: https://doi.org/10.1128/JCM.00339-07. PubMed: 17609323.
  • 44. Сато М., Сайто Р., Сакаи Т., Сано Ю., Нисикава М. и др. (2005)Молекулярная эпидемиология респираторно-синцитиальных вирусных инфекций среди детей с острыми респираторными симптомами в сообществе в течение трех сезонов. J Clin Microbiol 43: 36–40. doi: https://doi.org/10.1128/JCM.43.1.36-40.2005. PubMed: 15634948.
  • 45. Shobugawa Y, Saito R, Sano Y, Zaraket H, Suzuki Y и др.(2009)Новые генотипы подгруппы А респираторно-синцитиального вируса человека среди пациентов в Японии. J Clin Microbiol 47: 2475-2482. doi: https://doi.org/10.1128/JCM.00115-09. PubMed: 19553576.
  • 46. Boonyasuppayakorn S, Kowitdamrong E, Bhattarakosol P (2010)Молекулярный и демографический анализ респираторно-синцитиальной вирусной инфекции у пациентов, поступивших в Мемориальный госпиталь короля Чулалонгкорна, Таиланд, 2007. Influenza Other Respi Viruses 4: 313–323. дои: https://doi.org/10.1111/j.1750-2659.2010.00152.х. PubMed: 20716160.
  • 47. Vathanophas K, Sangchai R, Raktham S, Pariyanonda A (1990)Общественное исследование острых инфекций дыхательных путей у тайских детей. Rev Infect Dis 12: S957-S965. doi: https://doi.org/10.1093/cliniids/12.Supplement_8.S957. PubMed: 2270418.
  • 48. Тренто А., Вьегас М., Гальяно М., Видела С., Карбаллал Г. (2006)Естественная история респираторно-синцитиального вируса человека, выведенная на основе филогенетического анализа гликопротеина прикрепления (G) с 60-нуклеотидной дупликацией.Дж. Вирол 80: 975–984. doi: https://doi. org/10.1128/JVI.80.2.975-984.2006. PubMed: 16378999.
  • 49. Sullender WM (2000)Генетическое и антигенное разнообразие респираторно-синцитиального вируса. Clin Microbiol Rev 13: 1–15. doi: https://doi.org/10.1128/CMR.13.1.1-15.2000. PubMed: 10627488.
  • 50. Хансен Дж.Э., Лунд О., Толструп Н., Гули А.А., Уильямс К.Л. и соавт. (1998) NetOglyc: предсказание сайтов O-гликозилирования муцинового типа на основе контекста последовательности и доступности поверхности.Glycoconj J 15: 115–130. doi: https://doi.org/10.1023/A:1006960004440. PubMed: 9557871.
  • 51. Weber MW, Mulholland EK, Greenwood BM (1998) Респираторно-синцитиальная вирусная инфекция в тропических и развивающихся странах. Trop Med Int Health 3 (4): 268-280. doi: https://doi.org/10.1046/j.1365-3156.1998.00213.x. PubMed: 9623927.
  • 52. Oliveira TF, Freitas GR, Ribeiro LZ, Yokosawa J, Siqueira MM et al. (2008) Распространенность и клинические аспекты групп респираторно-синцитиального вируса А и В у детей, наблюдаемых в клинической больнице Уберландии 103. MG, Бразилия: Mem Inst Oswaldo Cruz. стр. 417–422.
  • Молекулярная характеристика генотипов циркулирующих респираторно-синцитиальных вирусов у пакистанских детей, 2010–2013 гг.

    https://doi.org/10.1016/j.jiph.2019.05.014Get rights and content острые инфекции нижних дыхательных путей в Пакистане встречаются редко. Респираторно-синцитиальный вирус человека (RSV) является важной причиной заболеваемости у детей, но в настоящее время не существует эффективной вакцины или противовирусной терапии.Поскольку вакцины, как ожидается, станут доступны в будущем, важно понимать эпидемиологию локально распространенных подтипов РСВ. Это исследование было направлено на определение молекулярной эпидемиологии генотипов РСВ (А и В) у пакистанских детей в возрасте до 5 лет.

    Методы

    Для отбора случаев использовались определения Всемирной организации здравоохранения для гриппоподобного заболевания (ГПЗ) и тяжелого острого респираторного заболевания (ТОРИ). В исследование были включены дети в возрасте до 5 лет, обратившиеся с ГПЗ или ТОРИ в больницы третичного уровня из всех провинций/регионов, включая восемь дозорных центров по гриппу, в течение октября–апреля каждого года в период с 2010 по 2013 год.Демографические и клинические данные детей были записаны, а мазки из носоглотки/горла взяты для анализа. Все образцы были протестированы на наличие РСВ А и В с использованием полимеразной цепной реакции в реальном времени на негриппозные респираторные вирусы. Специфические олигонуклеотидные праймеры для RSV A и B использовали для субтипирования и секвенирования G-белка с последующим филогенетическим анализом.

    Результаты

    Всего был включен 1941 образец. РСВ выявлен у 472 (24%) детей, РСВ А у 367 (78%), РСВ В у 105 (22%).Белок G всех штаммов RSV A сгруппирован в генотипе NA1/GA2, в то время как штаммы RSV B несут сигнатурную 60-нуклеотидную дупликацию и относятся к трем генотипам BA: BA-9, BA-10 и новому генотипу BA-13.

    Выводы

    Это исследование подчеркивает важность РСВ как вирусного этиологического агента острых респираторных инфекций у детей в Пакистане, а также разнообразие вирусов РСВ. Для понимания эпидемиологии инфекций РСВ в Пакистане необходим постоянный молекулярный надзор для раннего выявления распространенных и вновь появляющихся генотипов.

    Ключевые слова

    Ключевые слова

    Ключевые слова

    Респираторные синтетические вирусы

    Человека

    Ребенок

    Молекулярная эпидемия

    Генотип

    Генотип

    Pakistan

    Рекомендуемые статьи Статьи (0)

    Рекомендуемые статьи

    Ссылки

    IZA — Институт экономики труда

    Необходимо

    Эти необходимые файлы cookie необходимы для активации основных функций веб-сайта.Отказ от этих технологий недоступен.

    cb-включить

    Dieses Cookies speichert den Status der Cookie-Einwilligung des Benutzers für die aktuelle Domain. Срок действия: 1 год

    laravel_session

    Идентификатор сеанса um den Nutzer beim Neuladen wiederzuerkennen und seinen Login Status wiederherzustellen.Срок действия 2 часа

    XSRF-ТОКЕН

    CSRF-Schutz для формулы. Срок действия: 2 часа


    Аналитика

    Для дальнейшего улучшения нашего предложения и нашего веб-сайта мы собираем анонимные данные для статистики и анализа. С помощью этих файлов cookie мы можем, например, определить количество посетителей и влияние определенных страниц на нашем веб-сайте, а также оптимизировать наш контент.

    Berkshire идентифицирует преемника Баффета, а не по имени

    НЬЮ-ЙОРК: Уоррен Баффет сообщил инвесторам в субботу, что совет директоров Berkshire Hathaway определил его преемника, что ослабило опасения акционеров по поводу будущего компании после того, как знаменитый 81-летний инвестор уйдет с поста исполнительного директора.

    В своем ежегодном письме акционерам Berkshire Баффет не сообщил, кто станет следующим генеральным директором. Но он начал сообщение с темы преемственности, которая уже много лет является серьезной проблемой для акционеров.

    Затем он углубился в знакомые темы Баффета, а именно: его непрекращающийся аппетит к сделкам, его предпочтение акций казначейским обязательствам и золоту и его оптимистичный взгляд на экономику США.

    Компания из Омахи, штат Небраска, мало рассказала о том, кто заменит «Оракула из Омахи», и письмо содержало больше всего информации на сегодняшний день: Баффет ясно дал понять, что сейчас для него выбрана замена, а не список, из которого доска могла выбрать.

    «Ваше правление в равной степени с энтузиазмом относится к моему преемнику на посту генерального директора, человеку, с которым они много общались и чьими управленческими и человеческими качествами они восхищаются», — сказал он, добавив, что есть еще два запасных кандидата.

    Один из инвесторов Berkshire сказал, что самородок дополнительной ясности стал огромным облегчением, добавив, что он особенно доволен тем, что вопрос был рассмотрен в начале письма.

    «Я думаю, что вопрос о правопреемстве является очень важным вопросом для акционеров Berkshire и, возможно, даже для будущих владельцев», — сказал Дэвид Рольф, директор по инвестициям Wedgewood Partners и менеджер RiverPark/Wedgewood Fund.

    Несмотря на то, что Баффету за 80, известно, что он находится в добром здравии и ясно дал понять, что не планирует в ближайшее время отказываться от управления компанией. Но другой акционер сказал, что, по его мнению, уровень детализации субботнего письма свидетельствует о том, что грядут перемены.

    «Можно было бы счесть четкие детали планов преемственности благоразумными, но, по моему мнению, они не были бы столь явными в отношении преемственности, если бы не было какого-то двух- или трехлетнего плана ухода в отставку», сказал Майкл Йошиками, генеральный директор и основатель Destination Wealth Management.

    Известный своим плохим питанием, которое в значительной степени зависит от говядины, Баффет пошутил в письме, что он может потреблять еще 12 миллионов калорий перед смертью.

    Баффет также пересказал историю бывшего делового партнера Роуз Блюмкин, которая продала Баффету долю в Nebraska Furniture Mart, когда ей было 89 лет, но продолжала работать до 103 лет.

    «Выйдя на пенсию, она умерла в следующем году, последовательность, которую я указываю любому другому менеджеру Berkshire, который даже думает об уходе на пенсию», — написал Баффет.

    Баффет, который находится у руля Berkshire 47 лет, контролирует конгломерат, в котором работает более 270 000 человек по всему миру в десятках предприятий, от железных дорог и электроэнергетики до мороженого и нижнего белья.

    ДЖЕЙН ИЛИ ПЛАН Б?

    Хотя имя преемника неизвестно, среди наблюдателей за Berkshire чаще всего предполагают, что это Аджит Джейн, управляющий перестраховочным бизнесом Berkshire. Как обычно, Баффет и его партнер Чарли Мангер расточали ему похвалы в письме.

    «Чарли с радостью обменял бы меня на второго Аджита. Увы, его нет», — сказал Баффет.

    Помимо Джейна, в спекуляциях о преемнике всплывают еще четыре имени: глава Burlington Northern Мэтью Роуз, босс автострахования Geico Тони Найсли, Грег Абель из коммунальной компании MidAmerican и глава перестраховочной компании General Re Тэд Монтросс.

    Все четверо, как известно, восхищаются Баффетом, хотя ни один из них не пользуется таким большим успехом, как Джейн. Йошиками сказал, что по-прежнему считает, что Джейн — лучший выбор; Однако Рольфе из Wedgewood сказал, что более ограниченный опыт Джейна может быть недостатком.

    Он сказал, что лучшим кандидатом будет «парень, который знает культуру и меньше всего повлияет на основной бизнес, и я думаю, что это было бы красиво».

    Одно имя, которое явно отсутствовало в письме, было Давид Сокол.

    Когда-то один из лучших помощников Баффета и долгое время считавшийся его преемником, Сокол покинул Berkshire в прошлом году из-за проблем с ненадлежащей торговлей акциями.

    Этот эпизод вызвал запросы со стороны регуляторов рынка ценных бумаг и стал большой черной меткой в ​​послужном списке Баффета, но он вообще не упоминается в его подведении итогов года.

    Один инвестор, владевший акциями Berkshire более 25 лет, сказал, что никогда нельзя считать «выбор» нового генерального директора окончательным.

    «Я не думаю, что когда-либо будет проведена окончательная проверка вопросов преемственности. Подход Уоррена на протяжении многих лет заключался в том, чтобы сохранить возможность выбора лучшего человека», — сказал Томас А. Руссо, партнер Gardner Russo & Gardner. один из 10 крупнейших институциональных акционеров класса А Berkshire.

    УТОЧНЕНИЕ НАСЛЕДОВАНИЯ ИНВЕСТИЦИЙ

    Другая часть плана преемственности Berkshire — кто будет управлять огромным инвестиционным портфелем после ухода Баффета — гораздо яснее. Компания наняла двух инвестиционных менеджеров, Тодда Комбса и Теда Вешлера, каждый из которых управляет или скоро будет управлять активами почти на 2 миллиарда долларов.

    Баффет сказал в письме, что Комбс и Вешлер смогут управлять инвестиционным портфелем Berkshire после ухода Баффета. Ходили слухи, что Berkshire может добавить третьего менеджера в будущем.

    «Каждый из них будет управлять несколькими миллиардами долларов в 2012 году, но у них хватит ума, здравого смысла и характера, чтобы управлять всем нашим портфелем, когда мы с Чарли больше не будем управлять Berkshire», — сказал Баффет.

    Комбс и Вешлер уже сделали несколько заметных ставок, среди которых крупная доля в спутниковом вещателе DirecTV и недавняя позиция в контент-компании Liberty Media.

    Позже Баффет добавил, что эти двое, скорее всего, помогут новому генеральному директору совершать приобретения в будущем.

    ‘НА РЫСКЕ’

    Деятельность по слиянию была главной темой Баффета в прошлогоднем письме, в котором он, как известно, сказал, что у него есть заряженное ружье для слона, чтобы охотиться за крупными сделками, и зудящий палец на спусковом крючке.

    Он удовлетворил этот зуд несколько раз, в частности, потратил 9 миллиардов долларов на покупку химической компании Lubrizol, 5 миллиардов долларов на поддержку Bank of America с помощью привилегированных акций и 11 миллиардов долларов на то, чтобы стать крупнейшим акционером IBM.

    Баффет отметил в субботу, что он не закончил покупать, заявив, что Berkshire хотела бы заключить крупные сделки, чтобы увеличить операционную прибыль.

    «Моя задача ясна, и я на охоте», сказал он.

    Berkshire завершила 2011 год с наличными наличными в размере 37,3 млрд долларов, несмотря на то, что в последнем квартале прибыль сократилась.

    Баффет также сказал, что Berkshire продолжит инвестировать в такие вещи, как солнечная и ветровая энергия в MidAmerican, а также в акции и другие активы с определенной производительностью.

    В письме он воспользовался случаем, как он часто делал в прошлом, чтобы подвергнуть сомнению облигации, товары и валюту как инвестиционные возможности.

    «Мое собственное предпочтение — и вы знали, что это произойдет — это наша третья категория: инвестиции в производственные активы, будь то предприятия, фермы или недвижимость», — сказал Баффет.(Reuters)

    Городской тезаурус — Найдите синонимы для сленговых слов

    Как вы, наверное, заметили, сленговые синонимы термина перечислены выше. Обратите внимание, что из-за характера алгоритма некоторые результаты, возвращаемые вашим запросом, могут быть только понятиями, идеями или словами, связанными с термином (возможно, слабо). Это просто из-за того, как работает алгоритм поиска.

    Вы могли также заметить, что многие из синонимов или связанных сленговых слов являются расистскими/сексистскими/оскорбительными/совершенно ужасающими – в основном благодаря прекрасному сообществу в Urban Dictionary (не связанном с Urban Thesaurus).Urban Thesaurus просматривает сеть и собирает миллионы различных сленговых терминов, многие из которых происходят из UD и оказываются действительно ужасными и бесчувственными (я полагаю, это природа городского сленга). Надеемся, что родственные слова и синонимы для «термин» немного мягче, чем в среднем.

    Городской тезаурус

    Городской тезаурус был создан путем индексации миллионов различных сленговых терминов, которые определены на таких сайтах, как Urban Dictionary. Затем эти индексы используются для поиска корреляций использования между сленговыми терминами.Официальный API-интерфейс Urban Dictionary используется для отображения определений при наведении курсора. Обратите внимание, что этот тезаурус никоим образом не связан с Urban Dictionary.

    Из-за того, как работает алгоритм, тезаурус дает вам в основном родственное жаргонных слова, а не точные синонимы. Чем выше термины в списке, тем больше вероятность того, что они релевантны искомому слову или фразе. Алгоритм поиска довольно хорошо обрабатывает фразы и цепочки слов, поэтому, например, если вам нужны слова, связанные с lol и rofl , вы можете ввести lol rofl , и он должен дать вам кучу связанных сленговых терминов. Или вы можете попробовать парень или девушка , чтобы получить слова, которые могут означать одно из этих слов (например, bae ). Также обратите внимание, что из-за характера Интернета (и особенно UD) в результатах часто будет много ужасных и оскорбительных терминов.

    Предстоит еще много работы, чтобы этот тезаурус сленга давал неизменно хорошие результаты, но я думаю, что он находится на той стадии, когда он может быть полезен людям, поэтому я и выпустил его.

    Особая благодарность авторам открытого исходного кода, использованного в этом проекте: @krisk, @HubSpot и @mongodb.

    Наконец, вы можете ознакомиться с растущей коллекцией сленговых слов для различных тем на Slangpedia.

    Обратите внимание, что Urban Thesaurus использует сторонние скрипты (такие как Google Analytics и рекламные объявления), которые используют файлы cookie. Чтобы узнать больше, ознакомьтесь с политикой конфиденциальности.

    Публикации Джеффри А.

    Вайнберга, доктора медицины

    Публикации

    Показаны все 168 журнальных статей и 57 доступных книг

    Журнальные статьи

    24.12.2021
    JV, Michaels MG, Selvarangan R, Harrison CJ, Staat MA, Schlaudecker EP, Weinberg GA, Szilagyi PG, Boom JA, Sahni LC, Englund JA, Klein EJ, Ogokeh CE, Campbell AP, Patel MM, .«Эффективность вакцины против госпитализации гриппа и посещений отделений неотложной помощи в течение двух сезонов с преобладанием гриппа A(h4N2) среди детей в возрасте до 18 лет, Новая сеть эпиднадзора за вакцинами, 2016-17 и 2017-18». Журнал инфекционных болезней.. 2021 24 дек; Epub 2021, 24 декабря.

    23.12.2021
    Вайнберг Г.А., Нахман С. «Грудное вскармливание женщинами, живущими с ВИЧ, в США: действительно ли риски управляемы?» Журнал Общества детских инфекционных заболеваний.. 2021 23 декабря; Epub 2021 23 декабря.

    26.11.2021
    Шах М.М., Перес А., Лайвли Дж.Й., Авадханула В. , Бум Дж.А., Чаппелл Дж., Инглунд Дж.А., Фрего В., Халаса Н.Б., Харрисон С.Дж., Хикки Р.В., Кляйн Э.Дж. , McNeal MM, Michaels MG, Moffatt ME, Otten C, Sahni LC, Schlaudecker E, Schuster JE, Selvarangan R, Staat MA, Stewart LS, Weinberg GA, Williams JV, Ng TFF, Routh JA, Gerber SI, McMorrow ML, Rha Б, Миджли CM. «Острое респираторное заболевание, связанное с энтеровирусом D68? Новая сеть эпиднадзора за вакцинами, США, июль-ноябрь 2018–2020 гг.»MMWR. Еженедельный отчет о заболеваемости и смертности.. 26 ноября 2021 г.; 70(47):1623-1628. Epub 2021 26 ноября.

    26.10.2021
    Спикер А.Дж., Вандекар С., Стюарт Л.С., Уильямс Дж.В., Бум Дж.А., Муньос Ф., Инглунд Дж.А., Сельваранган Р., Стаат М.А., Вайнберг Г.А., Азими П.Х., Кляйн Э.Дж., Макнил М., Сахни Л.С., Сингер М.Н., Силаги П.Г., Харрисон С.Дж. , Патель М., Кэмпбелл А. П., Халаса Н. Б. «Клинические испытания гриппа и лечение осельтамивиром у госпитализированных детей с острыми респираторными заболеваниями, 2015–2016 гг. «Грипп и другие респираторные вирусы.. 26 октября 2021 г.; Epub 2021 26 октября.

    13.10.2021
    Tenforde MW, Campbell AP, Michaels MG, Harrison CJ, Klein EJ, Englund JA, Selvarangan R, Halasa NB , Стюарт Л.С., Вайнберг Г.А., Уильямс Дж.В., Силагьи П.Г., Стаат М.А., Бум Дж.А., Сахни Л.С., Сингер М.Н., Азими П.Х., Циммерман Р.К., Макнил М.М., Талбот Х.К., Монто А.С., Мартин Э.Т., Гаглани М., Сильвейра Ф.П., Миддлтон Д.Б., Фердинандс Дж. М., Рольфес М. А. «Практика клинического тестирования на грипп у госпитализированных детей в медицинских центрах США, 2015–2018 гг.Журнал Общества педиатрических инфекционистов. 13 октября 2021 года; Epub 13 октября 2021 года. L, Martin-Blais R, Palazzi D, Shane AL, Schuster JE, Shulman ST, Storch GA, Weinberg GA, Zaoutis T. «Приоритеты подачи заявок, связанные с COVID-19, из журнала Общества детских инфекционных заболеваний». 5 октября 2021 г., Epub 5 октября 2021 г.

    16.07.2021
    Jhaveri R, Adler-Shohet FC, Blyth CC, Chiotos K, Gerber JS, Green M, Kociolek L, Martin- Блейс Р. , Палацци Д., Шейн А.Л., Шустер Дж.Е., Шульман С.Т., Сторх Г.А., Вайнберг Г.А., Заутис Т.«Взвешивание рисков перимиокардита с учетом преимуществ вакцинации мРНК SARS-CoV-2 у подростков». Журнал Общества детских инфекционных заболеваний. 16 июля 2021 г .; Epub 2021 16 июля.

    01.07.2021
    Дуглас К.Э., Хейни М.Л., Вайнберг Г.А., Джонсон М.Д., Бхарадвадж Р., Уильямс З.Р. «Гранулематозный амебный энцефалит, имитирующий нейромиелит зрительного нерва». Журнал нейроофтальмологии: официальный журнал Североамериканского общества нейроофтальмологии.2021 1 июля; Epub 2021, 01 июля.

    09.06.2021
    Отто В.Р., Ламсон Д.М., Гонсалес Г., Вайнберг Г.А., Пекора Н.Д., Фишер Б.Т., Сент-Джордж К., Кайон А.Е. «Смертельный неонатальный сепсис, связанный с инфекцией аденовируса человека типа 56: геномный анализ трех недавних случаев, обнаруженных в Соединенных Штатах». Вирусы.. 2021 9 июня; 13(6)Epub 2021 09 июня.

    13.05.2021
    Хаддадин З. , Шустер Дж. Э., Шпикер А. Дж., Рахман Х., Блозински А., Стюарт Л., Кэмпбелл А. П., Лайвли Дж. Ю., Майклс М. Г., Уильямс Дж. В., Бум JA, Sahni LC, Staat M, McNeal M, Selvarangan R, Harrison CJ, Weinberg GA, Szilagyi PG, Englund JA, Klein EJ, Curns AT, Rha B, Langley GE, Hall AJ, Patel MM, Halasa NB.«Острые респираторные заболевания у детей во время пандемии SARS-CoV-2: проспективное многоцентровое исследование». Педиатрия.. 2021 13 мая; Epub 2021 May 13.

    02.04.2021
    Esona MD, Ward ML, Wikswo ME, Rustempasic SM, Gautam R, Perkins C, Selvarangan R, Harrison CJ, Boom JA, Englund JA, Klein EJ, Staat MA , McNeal MM, Halasa N, Chappell J, Weinberg GA, Payne DC, Parashar UD, Bowen MD. «Тенденции генотипа ротавируса и обнаружение желудочно-кишечных патогенов в Соединенных Штатах, 2014–2016 годы: результаты новой сети эпиднадзора за вакцинами».Журнал инфекционных заболеваний.. 2 апреля 2021 г.; Epub 2021 г., 02 апреля. , Staat MA, Klein EJ, McNeal M, Michaels MG, Sahni LC, Stewart LS, Szilagyi PG, Harrison CJ, Lively JY, Rha B, Patel M. «Влияние вакцинации на предотвращение связанных с гриппом госпитализаций среди детей во время тяжелого сезона» Ассоциировано с вирусами B/Victoria, 2019–2020 гг.». Клинические инфекционные заболевания: официальное издание Американского общества инфекционистов.. 2021 27 января; Epub 2021 27 января.

    1/2021
    Esona MD, Gautam R, Katz E, Jaime J, Ward ML, Wikswo ME, Betrapally NS, Rustempasic SM, Selvarangan R, Harrison CJ, Boom JA, Englund J, Klein EJ, Staat MA, McNeal MM, Halasa N, Chappell J, Weinberg GA, Payne DC, Parashar UD, Bowen MD. «Сравнительный геномный анализ ротавирусов геногруппы 1 и геногруппы 2, циркулирующих в семи городах США, 2014-2016 гг.». Эволюция вируса.. 0 января 2021 г .; 7(1):veab023. Epub 2021, 12 марта.

    12.10.2020
    Огоке К.Э., Кэмпбелл А.П., Фелдштейн Л.Р., Вайнберг Г.А., Стаат М.А., Макнил М.М., Селваранган Р., Халаса Н.Б., Инглунд Дж.А., Бум Дж.А., Азими П.Х., Силаджи П.Г. , Harrison CJ, Williams JV, Klein EJ, Stewart LS, Sahni LC, Singer MN, Lively JY, Payne DC, Patel M, . «Сравнение родительского отчета о вакцинации против гриппа с задокументированными записями о детях, госпитализированных с острым респираторным заболеванием, 2015–2016 годы». Журнал Общества детских инфекционных заболеваний. 2020 г., 12 октября; Epub 2020 12 окт. , Стюарт Л.С., Кляйн Э.Дж., Сахни Л.С., Силаги П.Г., Майклс М.Г., Хикки Р.В., Моффат М.Е., Пахуд Б.А., Шустер Д.Е., Уэддл Г.М., Ра Б., Фрай А.М., Патель М.«Эффективность вакцин против педиатрических госпитализаций гриппа и посещений неотложной помощи». Педиатрия.. 2020 5 окт; Epub 2020 05 октября.

    18.06.2020
    Rha B, Lively JY, Englund JA, Staat MA, Weinberg GA, Selvarangan R, Halasa NB, Williams JV, Boom JA, Sahni LC, Michaels MG, Stewart LS , Harrison CJ, Szilagyi PG, McNeal MM, Klein EJ, Strelitz B, Lacombe K, Schlaudecker E, Moffatt ME, Schuster JE, Pahud BA, Weddle G, Hickey RW, Avadhanula V, Wikswo ME, Hall AJ, Curns AT, Gerber СИ, Лэнгли Г.«Инфекции SARS-CoV-2 у детей — многоцентровое наблюдение, США, январь-март 2020 г. ». Журнал Общества педиатрических инфекционистов. 18 июня 2020 г .; Epub 2020 18 июня.

    16.06.2020
    Rha B, Curns AT, Lively JY, Campbell AP, Englund JA, Boom JA, Azimi PH, Weinberg GA, Staat MA, Selvarangan R, Halasa NB, McNeal MM , Кляйн Э.Дж., Харрисон С.Дж., Уильямс Дж.В., Силагьи П.Г., Сингер М.Н., Сахни Л.С., Фигероа-Даунинг Д., Макдэниел Д., Прилл М.М., Уитакер Б.Л., Стюарт Л.С., Шустер Д.Е., Пахуд Б.А., Уэддл Г., Авадханула В., Муньос Ф.М. , Пьедра П.А., Пейн Д.К., Лэнгли Г., Гербер С.И.«Госпитализация среди детей раннего возраста, связанная с респираторно-синцитиальным вирусом: 2015–2016 гг.». Педиатрия.. 2020 16 июня; Epub 2020 16 июня.

    01.06.2020
    Пахуд Б.А., Хассан Ф., Харрисон С.Дж., Халаса Н.Б., Чаппелл Д.Д., Инглунд Дж.А., Кляйн Э.Дж., Силагьи П.Г., Вайнберг Г.А., Шерман А.К., Полаж С., Wikswo ME , McDonald LC, Payne DC, Selvarangan R. «Обнаружение с помощью ПЦР в реальном времени у детей раннего возраста не предсказывает заболевания». Госпитальная педиатрия.. 1 июня 2020 г .; Epub 2020 01 июня.

    19.03.2020
    Вайнберг Г.А.«Живая аттенуированная вакцина против гриппа: настоящее и будущее». Журнал Общества педиатрических инфекционистов. 19 марта 2020 г .; 9 (Дополнение_1): S1-S2.

    19.03.2020
    Вайнберг Г.А. «Нетрадиционное использование живой аттенуированной вакцины против гриппа: вакцинация против гриппа в школах». Журнал Общества педиатрических инфекционистов. 19 марта 2020 г .; 9(Дополнение_1):S19-S23.

    28.02.2020
    Фельдштейн Л.Р., Огоке С., Рха Б., Вайнберг Г.А., Стаат М.А., Селваранган Р., Халаса Н.Б., Инглунд Дж.А., Бум Дж.А., Азими П.Х., Силагьи П.Г., Макнил М., Харрисон С.Дж., Уильямс JV, Кляйн Э.Дж., Сахни Л.С., Сингер М.Н., Лайвли Д.Ю., Пейн Д.К., Фрай А.М., Патель М., Кэмпбелл А.П.«Эффективность вакцины против госпитализации детей в связи с гриппом в США, 2015-2016 гг.». Журнал Общества детских инфекционных заболеваний. 28 февраля 2020 г .; Epub 2020 28 февраля.

    15.02.2020
    Staat MA, Payne DC, Halasa N, Weinberg GA, Donauer S, Wikswo M, McNeal M, Edwards KM, Szilagyi PG, Bernstein DI, Curns AT, Sulemana I , Эсона MD, Боуэн MD, Parashar UD, . «Продолжение данных о влиянии ротавирусной вакцины на детей в возрасте до 3 лет из Сети наблюдения за новыми вакцинами США — многоцентровой программы активного наблюдения, 2006–2016 годы.« Клинические инфекционные заболевания : официальная публикация Американского общества инфекционистов .. 2020 г., 15 февраля; Epub, 2020 г., 15 февраля. Рахими Х., О’Мэлли Н.Т., Хьюз И., Хаббен Л., Фэллон А.А., Каллимор М., Чатурведи А., Альтен Э.Д. «Больше не историческое заболевание: два случая детской цинги с рекомендациями для специалистов по лечению костей». Международный остеопороз: a журнал, основанный в результате сотрудничества между Европейским фондом остеопороза и Национальным фондом остеопороза США.. 2020 4 января; Epub 2020 04 января.

    18. 10.2019
    Пиндик Т., Холл А.Дж., Тейт Дж.Е., Кардемил К.В., Камбхампати А.К., Виксво М.Е., Пейн Д.К., Гритдал С., Бум Дж.А., Инглунд Дж.А., Клейн Э.Дж., Халаса Н. , Selvarangan R, Staat MA, Weinberg GA, Beenhouwer DO, Brown ST, Holodniy M, Lucero-Obusan C, Marconi VC, Rodriguez-Barradas MC, Parashar U. «Валидация международной классификации болезней, связанных с острым гастроэнтеритом, коды клинических модификаций» в педиатрическом и взрослом населении США». Клинические инфекционные заболевания: официальное издание Американского общества инфекционистов.. 2019 18 октября; Epub 2019 18 октября.

    04.09.2019
    Пейн, округ Колумбия, Инглунд Дж. А., Вайнберг Г. А., Халаса Н. Б., Бум Дж. А., Стаат М. А., Селваранган Р., Азими П. Х., Кляйн Э. Дж., Силагьи П. Г., Чаппелл Дж., Сахни Л. С. , Макнил М., Харрисон С.Дж., Моффатт М.Е., Джонстон С.Х., Миятович-Рустемпасич С., Эсона М.Д., Тейт Д.Е., Кернс А.Т., Виксво М.Е., Сулемана И., Боуэн М.Д., Парашар УД. «Связь вакцинации против ротавируса с обращениями в стационар и отделение неотложной помощи среди детей, обращающихся за помощью по поводу острого гастроэнтерита, 2010-2016 гг.» Сеть JAMA открыта.. 4 сентября 2019 г.; 2(9):e1